Mutagenetix > Incidental Mutations

Incidental Mutation 'R7563:Aox1'

585233

Institutional Source

Beutler Lab

Gene Symbol

Aox1

Ensembl Gene

ENSMUSG00000063558

Gene Name

aldehyde oxidase 1

Synonyms

Aox-1, Aox2, retinal oxidase, Aox-2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7563 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

58029931-58106413 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 58047145 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 70 (V70I)

Ref Sequence

ENSEMBL: ENSMUSP00000001027 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001027]

Predicted Effect

probably benign
Transcript: ENSMUST00000001027
AA Change: V70I

PolyPhen 2 Score 0.317 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000001027
Gene: ENSMUSG00000063558
AA Change: V70I

Domain	Start	End	E-Value	Type
Pfam:Fer2	8	78	8.5e-11	PFAM
Pfam:Fer2_2	87	161	2.4e-32	PFAM
low complexity region	197	209	N/A	INTRINSIC
Pfam:FAD_binding_5	238	418	1.2e-46	PFAM
CO_deh_flav_C	425	529	8.06e-24	SMART
Ald_Xan_dh_C	593	696	6.99e-42	SMART
Pfam:Ald_Xan_dh_C2	707	1240	2.1e-176	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aldehyde oxidase produces hydrogen peroxide and, under certain conditions, can catalyze the formation of superoxide. Aldehyde oxidase is a candidate gene for amyotrophic lateral sclerosis. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1520401A03Rik	A	T	17: 23,717,328	F8L	probably benign	Het
Aadacl3	A	G	4: 144,457,894	I98T	probably damaging	Het
Ahnak	T	C	19: 9,011,165	I3271T	probably damaging	Het
Ap1g2	A	G	14: 55,099,749	S710P	probably damaging	Het
Bhlhe40	TG	TGG	6: 108,664,857		probably null	Het
Cacna1e	T	C	1: 154,471,416	K1064E	probably benign	Het
Capn11	T	A	17: 45,633,965	I459F	probably damaging	Het
Ccnc	A	G	4: 21,732,220	I48V	probably damaging	Het
Ces1d	T	A	8: 93,178,039	I358F	probably benign	Het
Clgn	A	T	8: 83,420,556	N379I	probably damaging	Het
Cym	T	C	3: 107,214,232	Y248C	probably damaging	Het
Epha8	T	C	4: 136,938,789	D352G	possibly damaging	Het
Eya2	T	C	2: 165,716,130		probably null	Het
Fbxl5	C	T	5: 43,821,549	V20I	probably benign	Het
Fscb	T	C	12: 64,473,285	E469G	possibly damaging	Het
Glt8d2	A	T	10: 82,660,825		probably null	Het
Gm13088	A	T	4: 143,654,105	Y449*	probably null	Het
Helt	T	C	8: 46,293,593		probably benign	Het
Igkv8-27	G	T	6: 70,171,903	T89K	probably benign	Het
Ipo5	T	A	14: 120,946,155	H1048Q	probably benign	Het
Kalrn	T	C	16: 34,392,094	D28G	probably damaging	Het
Kcnh4	G	A	11: 100,741,854	P936S	probably benign	Het
Klrd1	A	G	6: 129,593,738	I37M	possibly damaging	Het
Kmt2e	T	C	5: 23,500,273	V1267A	probably damaging	Het
Lrrc29	A	G	8: 105,315,756	C147R	probably benign	Het
March1	A	T	8: 66,468,313	Q214L	probably damaging	Het
Mlip	G	T	9: 77,112,997	H52N	probably damaging	Het
Oas1e	T	C	5: 120,788,956	R229G	probably benign	Het
Ogfr	T	A	2: 180,592,507		probably null	Het
Olfr1023	T	A	2: 85,887,138	Y113N	probably damaging	Het
Olfr1279	T	C	2: 111,306,789	F195L	probably benign	Het
Pde4d	T	C	13: 109,951,007	I636T	probably benign	Het
Pex5l	C	T	3: 32,954,476	V426I	probably damaging	Het
Pmfbp1	A	G	8: 109,525,374	K384E	possibly damaging	Het
Prl6a1	T	G	13: 27,314,238		probably null	Het
Prss23	A	T	7: 89,509,830	W344R	probably damaging	Het
Ptar1	T	A	19: 23,720,316	D397E	probably benign	Het
Qrsl1	G	A	10: 43,876,517	R437C	probably damaging	Het
Rab6a	G	T	7: 100,608,197		probably benign	Het
Samd14	C	A	11: 95,021,413	S205R	probably benign	Het
Sel1l3	T	C	5: 53,185,984	Y322C	probably damaging	Het
Slc30a5	A	T	13: 100,803,972	L669I	probably benign	Het
Ssc4d	A	G	5: 135,963,033	L419P	probably damaging	Het
Tbc1d2b	A	T	9: 90,219,010	Y642*	probably null	Het
Tbc1d2b	A	C	9: 90,226,248	F417V	probably benign	Het
Top2a	T	C	11: 99,016,179	D212G	probably damaging	Het
Trim39	A	T	17: 36,260,915	V317E	probably damaging	Het
Uncx	G	A	5: 139,544,506	R113H	probably damaging	Het
Usp4	A	G	9: 108,379,344	S655G	probably benign	Het
Vmn2r114	C	T	17: 23,291,026	V827I	probably benign	Het
Vmn2r28	T	A	7: 5,488,201	N349I	probably benign	Het
Vmn2r3	A	G	3: 64,275,349	W310R	possibly damaging	Het
Xirp2	T	C	2: 67,509,901	W829R	probably damaging	Het
Zfp574	C	A	7: 25,081,352	H600N	possibly damaging	Het

Other mutations in Aox1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Aox1	APN	1	58059044	missense	probably damaging	1.00
IGL01077:Aox1	APN	1	58057410	splice site	probably benign
IGL01335:Aox1	APN	1	58082153	nonsense	probably null
IGL01410:Aox1	APN	1	58106025	splice site	probably null
IGL01684:Aox1	APN	1	58077581	splice site	probably null
IGL01727:Aox1	APN	1	58073228	nonsense	probably null
IGL01805:Aox1	APN	1	58081513	missense	possibly damaging	0.94
IGL01996:Aox1	APN	1	58082066	missense	probably benign	0.11
IGL02060:Aox1	APN	1	58097955	missense	possibly damaging	0.95
IGL02206:Aox1	APN	1	58065340	missense	probably benign	0.00
IGL02839:Aox1	APN	1	58068784	missense	probably benign	0.05
IGL02975:Aox1	APN	1	58068391	missense	probably damaging	1.00
IGL03062:Aox1	APN	1	58078465	missense	probably benign	0.01
IGL03286:Aox1	APN	1	58049384	missense	probably benign	0.19
IGL03335:Aox1	APN	1	58076160	missense	probably damaging	0.98
IGL03395:Aox1	APN	1	58068725	splice site	probably benign
R0048:Aox1	UTSW	1	58073212	missense	probably damaging	0.98
R0144:Aox1	UTSW	1	58070074	missense	probably benign	0.00
R0207:Aox1	UTSW	1	58105014	missense	possibly damaging	0.82
R0357:Aox1	UTSW	1	58092516	missense	probably damaging	1.00
R0383:Aox1	UTSW	1	58061241	missense	probably benign	0.00
R0399:Aox1	UTSW	1	58068849	splice site	probably null
R0465:Aox1	UTSW	1	58062207	missense	probably damaging	1.00
R0480:Aox1	UTSW	1	58043651	splice site	probably benign
R1005:Aox1	UTSW	1	58065352	missense	probably benign	0.00
R1507:Aox1	UTSW	1	58104451	missense	probably benign	0.01
R1597:Aox1	UTSW	1	58047167	missense	probably damaging	1.00
R1693:Aox1	UTSW	1	58085542	missense	probably damaging	1.00
R1709:Aox1	UTSW	1	58077474	missense	probably benign
R1869:Aox1	UTSW	1	58076103	missense	probably damaging	1.00
R1870:Aox1	UTSW	1	58076103	missense	probably damaging	1.00
R1898:Aox1	UTSW	1	58078442	missense	probably damaging	1.00
R1908:Aox1	UTSW	1	58102624	missense	probably damaging	1.00
R2002:Aox1	UTSW	1	58047141	missense	possibly damaging	0.69
R2062:Aox1	UTSW	1	58059192	splice site	probably null
R2065:Aox1	UTSW	1	58059192	splice site	probably null
R2265:Aox1	UTSW	1	58081520	missense	probably damaging	0.99
R3713:Aox1	UTSW	1	58056215	missense	probably benign	0.01
R3778:Aox1	UTSW	1	58053703	missense	possibly damaging	0.89
R4198:Aox1	UTSW	1	58085607	missense	probably benign
R4296:Aox1	UTSW	1	58057400	splice site	probably null
R4562:Aox1	UTSW	1	58059056	missense	probably damaging	0.99
R4858:Aox1	UTSW	1	58104481	missense	probably benign
R4862:Aox1	UTSW	1	58095157	missense	probably damaging	0.98
R5048:Aox1	UTSW	1	58059482	splice site	probably benign
R5127:Aox1	UTSW	1	58030026	missense	probably benign	0.00
R5139:Aox1	UTSW	1	58061297	missense	probably benign	0.03
R5157:Aox1	UTSW	1	58070063	missense	probably damaging	1.00
R5168:Aox1	UTSW	1	58049402	missense	probably damaging	1.00
R5186:Aox1	UTSW	1	58068370	missense	probably damaging	1.00
R5235:Aox1	UTSW	1	58057555	missense	possibly damaging	0.77
R5289:Aox1	UTSW	1	58092558	missense	probably damaging	0.99
R5466:Aox1	UTSW	1	58041460	missense	probably damaging	1.00
R5540:Aox1	UTSW	1	58104410	missense	probably benign	0.03
R5615:Aox1	UTSW	1	58096966	missense	probably benign
R5652:Aox1	UTSW	1	58095197	missense	probably damaging	1.00
R5920:Aox1	UTSW	1	58049472	missense	probably damaging	1.00
R6008:Aox1	UTSW	1	58077513	missense	probably damaging	1.00
R6073:Aox1	UTSW	1	58104509	critical splice donor site	probably null
R6215:Aox1	UTSW	1	58085461	missense	probably benign
R6403:Aox1	UTSW	1	58068435	missense	probably damaging	1.00
R6440:Aox1	UTSW	1	58094472	missense	probably damaging	1.00
R6601:Aox1	UTSW	1	58063506	missense	probably damaging	1.00
R6608:Aox1	UTSW	1	58057546	missense	probably benign	0.40
R6752:Aox1	UTSW	1	58047239	missense	probably benign	0.00
R6989:Aox1	UTSW	1	58085452	missense	probably damaging	1.00
R7042:Aox1	UTSW	1	58102600	missense	probably damaging	0.99
R7442:Aox1	UTSW	1	58082013	missense	probably damaging	1.00
R7506:Aox1	UTSW	1	58049403	missense	probably damaging	1.00
R7589:Aox1	UTSW	1	58041484	missense	probably damaging	1.00
R7735:Aox1	UTSW	1	58068292	missense	probably benign	0.01
R7814:Aox1	UTSW	1	58085467	missense	probably benign
R7876:Aox1	UTSW	1	58062171	nonsense	probably null
R7905:Aox1	UTSW	1	58104398	missense	possibly damaging	0.72
R7908:Aox1	UTSW	1	58106068	missense	possibly damaging	0.68
R7959:Aox1	UTSW	1	58062171	nonsense	probably null
R7988:Aox1	UTSW	1	58104398	missense	possibly damaging	0.72
R7989:Aox1	UTSW	1	58106068	missense	possibly damaging	0.68
Z1088:Aox1	UTSW	1	58081542	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TGTCAGCCCCGATCTAGAAG -3'
(R):5'- GTTAGGAGTGACCAAGCAGTC -3'

Sequencing Primer
(F):5'- GTGACCCTGAATAGATCACTCTG -3'
(R):5'- GAGTGACCAAGCAGTCCAACC -3'

Posted On

2019-10-17