Incidental Mutation 'R7563:Aox1'
ID585233
Institutional Source Beutler Lab
Gene Symbol Aox1
Ensembl Gene ENSMUSG00000063558
Gene Namealdehyde oxidase 1
SynonymsAox-1, Aox2, retinal oxidase, Aox-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7563 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location58029931-58106413 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 58047145 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 70 (V70I)
Ref Sequence ENSEMBL: ENSMUSP00000001027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001027]
Predicted Effect probably benign
Transcript: ENSMUST00000001027
AA Change: V70I

PolyPhen 2 Score 0.317 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000001027
Gene: ENSMUSG00000063558
AA Change: V70I

DomainStartEndE-ValueType
Pfam:Fer2 8 78 8.5e-11 PFAM
Pfam:Fer2_2 87 161 2.4e-32 PFAM
low complexity region 197 209 N/A INTRINSIC
Pfam:FAD_binding_5 238 418 1.2e-46 PFAM
CO_deh_flav_C 425 529 8.06e-24 SMART
Ald_Xan_dh_C 593 696 6.99e-42 SMART
Pfam:Ald_Xan_dh_C2 707 1240 2.1e-176 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aldehyde oxidase produces hydrogen peroxide and, under certain conditions, can catalyze the formation of superoxide. Aldehyde oxidase is a candidate gene for amyotrophic lateral sclerosis. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik A T 17: 23,717,328 F8L probably benign Het
Aadacl3 A G 4: 144,457,894 I98T probably damaging Het
Ahnak T C 19: 9,011,165 I3271T probably damaging Het
Ap1g2 A G 14: 55,099,749 S710P probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Cacna1e T C 1: 154,471,416 K1064E probably benign Het
Capn11 T A 17: 45,633,965 I459F probably damaging Het
Ccnc A G 4: 21,732,220 I48V probably damaging Het
Ces1d T A 8: 93,178,039 I358F probably benign Het
Clgn A T 8: 83,420,556 N379I probably damaging Het
Cym T C 3: 107,214,232 Y248C probably damaging Het
Epha8 T C 4: 136,938,789 D352G possibly damaging Het
Eya2 T C 2: 165,716,130 probably null Het
Fbxl5 C T 5: 43,821,549 V20I probably benign Het
Fscb T C 12: 64,473,285 E469G possibly damaging Het
Glt8d2 A T 10: 82,660,825 probably null Het
Gm13088 A T 4: 143,654,105 Y449* probably null Het
Helt T C 8: 46,293,593 probably benign Het
Igkv8-27 G T 6: 70,171,903 T89K probably benign Het
Ipo5 T A 14: 120,946,155 H1048Q probably benign Het
Kalrn T C 16: 34,392,094 D28G probably damaging Het
Kcnh4 G A 11: 100,741,854 P936S probably benign Het
Klrd1 A G 6: 129,593,738 I37M possibly damaging Het
Kmt2e T C 5: 23,500,273 V1267A probably damaging Het
Lrrc29 A G 8: 105,315,756 C147R probably benign Het
March1 A T 8: 66,468,313 Q214L probably damaging Het
Mlip G T 9: 77,112,997 H52N probably damaging Het
Oas1e T C 5: 120,788,956 R229G probably benign Het
Ogfr T A 2: 180,592,507 probably null Het
Olfr1023 T A 2: 85,887,138 Y113N probably damaging Het
Olfr1279 T C 2: 111,306,789 F195L probably benign Het
Pde4d T C 13: 109,951,007 I636T probably benign Het
Pex5l C T 3: 32,954,476 V426I probably damaging Het
Pmfbp1 A G 8: 109,525,374 K384E possibly damaging Het
Prl6a1 T G 13: 27,314,238 probably null Het
Prss23 A T 7: 89,509,830 W344R probably damaging Het
Ptar1 T A 19: 23,720,316 D397E probably benign Het
Qrsl1 G A 10: 43,876,517 R437C probably damaging Het
Rab6a G T 7: 100,608,197 probably benign Het
Samd14 C A 11: 95,021,413 S205R probably benign Het
Sel1l3 T C 5: 53,185,984 Y322C probably damaging Het
Slc30a5 A T 13: 100,803,972 L669I probably benign Het
Ssc4d A G 5: 135,963,033 L419P probably damaging Het
Tbc1d2b A T 9: 90,219,010 Y642* probably null Het
Tbc1d2b A C 9: 90,226,248 F417V probably benign Het
Top2a T C 11: 99,016,179 D212G probably damaging Het
Trim39 A T 17: 36,260,915 V317E probably damaging Het
Uncx G A 5: 139,544,506 R113H probably damaging Het
Usp4 A G 9: 108,379,344 S655G probably benign Het
Vmn2r114 C T 17: 23,291,026 V827I probably benign Het
Vmn2r28 T A 7: 5,488,201 N349I probably benign Het
Vmn2r3 A G 3: 64,275,349 W310R possibly damaging Het
Xirp2 T C 2: 67,509,901 W829R probably damaging Het
Zfp574 C A 7: 25,081,352 H600N possibly damaging Het
Other mutations in Aox1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Aox1 APN 1 58059044 missense probably damaging 1.00
IGL01077:Aox1 APN 1 58057410 splice site probably benign
IGL01335:Aox1 APN 1 58082153 nonsense probably null
IGL01410:Aox1 APN 1 58106025 splice site probably null
IGL01684:Aox1 APN 1 58077581 splice site probably null
IGL01727:Aox1 APN 1 58073228 nonsense probably null
IGL01805:Aox1 APN 1 58081513 missense possibly damaging 0.94
IGL01996:Aox1 APN 1 58082066 missense probably benign 0.11
IGL02060:Aox1 APN 1 58097955 missense possibly damaging 0.95
IGL02206:Aox1 APN 1 58065340 missense probably benign 0.00
IGL02839:Aox1 APN 1 58068784 missense probably benign 0.05
IGL02975:Aox1 APN 1 58068391 missense probably damaging 1.00
IGL03062:Aox1 APN 1 58078465 missense probably benign 0.01
IGL03286:Aox1 APN 1 58049384 missense probably benign 0.19
IGL03335:Aox1 APN 1 58076160 missense probably damaging 0.98
IGL03395:Aox1 APN 1 58068725 splice site probably benign
R0048:Aox1 UTSW 1 58073212 missense probably damaging 0.98
R0144:Aox1 UTSW 1 58070074 missense probably benign 0.00
R0207:Aox1 UTSW 1 58105014 missense possibly damaging 0.82
R0357:Aox1 UTSW 1 58092516 missense probably damaging 1.00
R0383:Aox1 UTSW 1 58061241 missense probably benign 0.00
R0399:Aox1 UTSW 1 58068849 splice site probably null
R0465:Aox1 UTSW 1 58062207 missense probably damaging 1.00
R0480:Aox1 UTSW 1 58043651 splice site probably benign
R1005:Aox1 UTSW 1 58065352 missense probably benign 0.00
R1507:Aox1 UTSW 1 58104451 missense probably benign 0.01
R1597:Aox1 UTSW 1 58047167 missense probably damaging 1.00
R1693:Aox1 UTSW 1 58085542 missense probably damaging 1.00
R1709:Aox1 UTSW 1 58077474 missense probably benign
R1869:Aox1 UTSW 1 58076103 missense probably damaging 1.00
R1870:Aox1 UTSW 1 58076103 missense probably damaging 1.00
R1898:Aox1 UTSW 1 58078442 missense probably damaging 1.00
R1908:Aox1 UTSW 1 58102624 missense probably damaging 1.00
R2002:Aox1 UTSW 1 58047141 missense possibly damaging 0.69
R2062:Aox1 UTSW 1 58059192 splice site probably null
R2065:Aox1 UTSW 1 58059192 splice site probably null
R2265:Aox1 UTSW 1 58081520 missense probably damaging 0.99
R3713:Aox1 UTSW 1 58056215 missense probably benign 0.01
R3778:Aox1 UTSW 1 58053703 missense possibly damaging 0.89
R4198:Aox1 UTSW 1 58085607 missense probably benign
R4296:Aox1 UTSW 1 58057400 splice site probably null
R4562:Aox1 UTSW 1 58059056 missense probably damaging 0.99
R4858:Aox1 UTSW 1 58104481 missense probably benign
R4862:Aox1 UTSW 1 58095157 missense probably damaging 0.98
R5048:Aox1 UTSW 1 58059482 splice site probably benign
R5127:Aox1 UTSW 1 58030026 missense probably benign 0.00
R5139:Aox1 UTSW 1 58061297 missense probably benign 0.03
R5157:Aox1 UTSW 1 58070063 missense probably damaging 1.00
R5168:Aox1 UTSW 1 58049402 missense probably damaging 1.00
R5186:Aox1 UTSW 1 58068370 missense probably damaging 1.00
R5235:Aox1 UTSW 1 58057555 missense possibly damaging 0.77
R5289:Aox1 UTSW 1 58092558 missense probably damaging 0.99
R5466:Aox1 UTSW 1 58041460 missense probably damaging 1.00
R5540:Aox1 UTSW 1 58104410 missense probably benign 0.03
R5615:Aox1 UTSW 1 58096966 missense probably benign
R5652:Aox1 UTSW 1 58095197 missense probably damaging 1.00
R5920:Aox1 UTSW 1 58049472 missense probably damaging 1.00
R6008:Aox1 UTSW 1 58077513 missense probably damaging 1.00
R6073:Aox1 UTSW 1 58104509 critical splice donor site probably null
R6215:Aox1 UTSW 1 58085461 missense probably benign
R6403:Aox1 UTSW 1 58068435 missense probably damaging 1.00
R6440:Aox1 UTSW 1 58094472 missense probably damaging 1.00
R6601:Aox1 UTSW 1 58063506 missense probably damaging 1.00
R6608:Aox1 UTSW 1 58057546 missense probably benign 0.40
R6752:Aox1 UTSW 1 58047239 missense probably benign 0.00
R6989:Aox1 UTSW 1 58085452 missense probably damaging 1.00
R7042:Aox1 UTSW 1 58102600 missense probably damaging 0.99
R7442:Aox1 UTSW 1 58082013 missense probably damaging 1.00
R7506:Aox1 UTSW 1 58049403 missense probably damaging 1.00
R7589:Aox1 UTSW 1 58041484 missense probably damaging 1.00
R7735:Aox1 UTSW 1 58068292 missense probably benign 0.01
R7814:Aox1 UTSW 1 58085467 missense probably benign
R7876:Aox1 UTSW 1 58062171 nonsense probably null
R7905:Aox1 UTSW 1 58104398 missense possibly damaging 0.72
R7908:Aox1 UTSW 1 58106068 missense possibly damaging 0.68
R7959:Aox1 UTSW 1 58062171 nonsense probably null
R7988:Aox1 UTSW 1 58104398 missense possibly damaging 0.72
R7989:Aox1 UTSW 1 58106068 missense possibly damaging 0.68
Z1088:Aox1 UTSW 1 58081542 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGTCAGCCCCGATCTAGAAG -3'
(R):5'- GTTAGGAGTGACCAAGCAGTC -3'

Sequencing Primer
(F):5'- GTGACCCTGAATAGATCACTCTG -3'
(R):5'- GAGTGACCAAGCAGTCCAACC -3'
Posted On2019-10-17