Incidental Mutation 'R7563:Xirp2'
ID585235
Institutional Source Beutler Lab
Gene Symbol Xirp2
Ensembl Gene ENSMUSG00000027022
Gene Namexin actin-binding repeat containing 2
Synonyms2310003D02Rik, 2310008C07Rik, myomaxin, Cmya3, A530024P18Rik, mXin beta
Accession Numbers

Genbank: NM_001024618, NM_001083919; MGI: 2685198

Is this an essential gene? Possibly non essential (E-score: 0.311) question?
Stock #R7563 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location67446002-67526614 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 67509901 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 829 (W829R)
Ref Sequence ENSEMBL: ENSMUSP00000028410 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028410] [ENSMUST00000112347]
Predicted Effect probably damaging
Transcript: ENSMUST00000028410
AA Change: W829R

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000028410
Gene: ENSMUSG00000027022
AA Change: W829R

DomainStartEndE-ValueType
low complexity region 176 188 N/A INTRINSIC
low complexity region 194 208 N/A INTRINSIC
low complexity region 289 298 N/A INTRINSIC
Pfam:Xin 343 358 4e-9 PFAM
Pfam:Xin 384 398 7.6e-10 PFAM
Pfam:Xin 420 435 6.4e-9 PFAM
Pfam:Xin 458 473 5.3e-9 PFAM
Pfam:Xin 536 551 4.1e-12 PFAM
Pfam:Xin 574 588 2.1e-8 PFAM
Pfam:Xin 609 623 6e-9 PFAM
Pfam:Xin 642 656 5.6e-8 PFAM
Pfam:Xin 679 693 5.9e-8 PFAM
Pfam:Xin 784 799 1.1e-10 PFAM
Pfam:Xin 822 837 3.9e-11 PFAM
Pfam:Xin 861 875 8.6e-12 PFAM
Pfam:Xin 894 909 2.8e-10 PFAM
Pfam:Xin 1006 1021 3.1e-9 PFAM
Pfam:Xin 1079 1094 6.7e-10 PFAM
Pfam:Xin 1117 1132 1.5e-10 PFAM
Pfam:Xin 1154 1169 2.4e-8 PFAM
Pfam:Xin 1256 1271 4.6e-8 PFAM
Pfam:Xin 1292 1305 1.6e-8 PFAM
low complexity region 1314 1325 N/A INTRINSIC
low complexity region 1547 1559 N/A INTRINSIC
coiled coil region 1683 1704 N/A INTRINSIC
low complexity region 1862 1871 N/A INTRINSIC
low complexity region 2031 2043 N/A INTRINSIC
low complexity region 2052 2063 N/A INTRINSIC
low complexity region 2087 2093 N/A INTRINSIC
low complexity region 2105 2123 N/A INTRINSIC
low complexity region 2159 2177 N/A INTRINSIC
coiled coil region 2288 2311 N/A INTRINSIC
coiled coil region 2738 2767 N/A INTRINSIC
low complexity region 2794 2804 N/A INTRINSIC
low complexity region 2906 2919 N/A INTRINSIC
LIM 3256 3308 4.45e-12 SMART
low complexity region 3356 3367 N/A INTRINSIC
low complexity region 3549 3565 N/A INTRINSIC
low complexity region 3614 3625 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112347
AA Change: W829R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107966
Gene: ENSMUSG00000027022
AA Change: W829R

DomainStartEndE-ValueType
low complexity region 176 188 N/A INTRINSIC
low complexity region 194 208 N/A INTRINSIC
low complexity region 289 298 N/A INTRINSIC
Pfam:Xin 343 358 4.3e-8 PFAM
Pfam:Xin 383 398 6.9e-9 PFAM
Pfam:Xin 420 435 1.8e-8 PFAM
Pfam:Xin 458 473 6.9e-8 PFAM
Pfam:Xin 536 551 2.8e-10 PFAM
Pfam:Xin 608 623 2.4e-8 PFAM
Pfam:Xin 642 657 1.7e-7 PFAM
Pfam:Xin 784 799 3.5e-9 PFAM
Pfam:Xin 822 837 8.9e-10 PFAM
Pfam:Xin 861 876 3.9e-10 PFAM
Pfam:Xin 894 909 5.4e-9 PFAM
Pfam:Xin 1006 1021 6.2e-8 PFAM
Pfam:Xin 1079 1094 2.4e-8 PFAM
Pfam:Xin 1117 1132 9.5e-9 PFAM
Pfam:Xin 1291 1306 5.8e-8 PFAM
low complexity region 1314 1325 N/A INTRINSIC
low complexity region 1547 1559 N/A INTRINSIC
coiled coil region 1683 1704 N/A INTRINSIC
low complexity region 1862 1871 N/A INTRINSIC
low complexity region 2031 2043 N/A INTRINSIC
low complexity region 2052 2063 N/A INTRINSIC
low complexity region 2087 2093 N/A INTRINSIC
low complexity region 2105 2123 N/A INTRINSIC
low complexity region 2159 2177 N/A INTRINSIC
coiled coil region 2288 2311 N/A INTRINSIC
coiled coil region 2738 2767 N/A INTRINSIC
low complexity region 2794 2804 N/A INTRINSIC
low complexity region 2906 2919 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype Strain: 4947971; 4453315
Lethality: D3-D21
PHENOTYPE: Homozygous null mice have an abnormal heart shape, ventricular septal defects, a failure of mature intercalated disc formation, severe growth retardation, and postnatal lethality. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted(5)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik A T 17: 23,717,328 F8L probably benign Het
Aadacl3 A G 4: 144,457,894 I98T probably damaging Het
Ahnak T C 19: 9,011,165 I3271T probably damaging Het
Aox1 G A 1: 58,047,145 V70I probably benign Het
Ap1g2 A G 14: 55,099,749 S710P probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Cacna1e T C 1: 154,471,416 K1064E probably benign Het
Capn11 T A 17: 45,633,965 I459F probably damaging Het
Ccnc A G 4: 21,732,220 I48V probably damaging Het
Ces1d T A 8: 93,178,039 I358F probably benign Het
Clgn A T 8: 83,420,556 N379I probably damaging Het
Cym T C 3: 107,214,232 Y248C probably damaging Het
Epha8 T C 4: 136,938,789 D352G possibly damaging Het
Eya2 T C 2: 165,716,130 probably null Het
Fbxl5 C T 5: 43,821,549 V20I probably benign Het
Fscb T C 12: 64,473,285 E469G possibly damaging Het
Glt8d2 A T 10: 82,660,825 probably null Het
Gm13088 A T 4: 143,654,105 Y449* probably null Het
Helt T C 8: 46,293,593 probably benign Het
Igkv8-27 G T 6: 70,171,903 T89K probably benign Het
Ipo5 T A 14: 120,946,155 H1048Q probably benign Het
Kalrn T C 16: 34,392,094 D28G probably damaging Het
Kcnh4 G A 11: 100,741,854 P936S probably benign Het
Klrd1 A G 6: 129,593,738 I37M possibly damaging Het
Kmt2e T C 5: 23,500,273 V1267A probably damaging Het
Lrrc29 A G 8: 105,315,756 C147R probably benign Het
March1 A T 8: 66,468,313 Q214L probably damaging Het
Mlip G T 9: 77,112,997 H52N probably damaging Het
Oas1e T C 5: 120,788,956 R229G probably benign Het
Ogfr T A 2: 180,592,507 probably null Het
Olfr1023 T A 2: 85,887,138 Y113N probably damaging Het
Olfr1279 T C 2: 111,306,789 F195L probably benign Het
Pde4d T C 13: 109,951,007 I636T probably benign Het
Pex5l C T 3: 32,954,476 V426I probably damaging Het
Pmfbp1 A G 8: 109,525,374 K384E possibly damaging Het
Prl6a1 T G 13: 27,314,238 probably null Het
Prss23 A T 7: 89,509,830 W344R probably damaging Het
Ptar1 T A 19: 23,720,316 D397E probably benign Het
Qrsl1 G A 10: 43,876,517 R437C probably damaging Het
Rab6a G T 7: 100,608,197 probably benign Het
Samd14 C A 11: 95,021,413 S205R probably benign Het
Sel1l3 T C 5: 53,185,984 Y322C probably damaging Het
Slc30a5 A T 13: 100,803,972 L669I probably benign Het
Ssc4d A G 5: 135,963,033 L419P probably damaging Het
Tbc1d2b A T 9: 90,219,010 Y642* probably null Het
Tbc1d2b A C 9: 90,226,248 F417V probably benign Het
Top2a T C 11: 99,016,179 D212G probably damaging Het
Trim39 A T 17: 36,260,915 V317E probably damaging Het
Uncx G A 5: 139,544,506 R113H probably damaging Het
Usp4 A G 9: 108,379,344 S655G probably benign Het
Vmn2r114 C T 17: 23,291,026 V827I probably benign Het
Vmn2r28 T A 7: 5,488,201 N349I probably benign Het
Vmn2r3 A G 3: 64,275,349 W310R possibly damaging Het
Zfp574 C A 7: 25,081,352 H600N possibly damaging Het
Other mutations in Xirp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Xirp2 APN 2 67513375 missense probably benign 0.37
IGL00336:Xirp2 APN 2 67512598 missense possibly damaging 0.93
IGL00596:Xirp2 APN 2 67514882 missense probably benign 0.08
IGL00862:Xirp2 APN 2 67516903 missense probably benign 0.00
IGL01124:Xirp2 APN 2 67508615 missense probably damaging 0.99
IGL01289:Xirp2 APN 2 67513181 missense probably damaging 0.99
IGL01293:Xirp2 APN 2 67515184 missense possibly damaging 0.51
IGL01372:Xirp2 APN 2 67513990 missense possibly damaging 0.93
IGL01385:Xirp2 APN 2 67509677 missense probably damaging 0.99
IGL01411:Xirp2 APN 2 67514083 missense probably benign 0.00
IGL01413:Xirp2 APN 2 67509926 missense probably damaging 1.00
IGL01551:Xirp2 APN 2 67513505 missense probably benign
IGL01672:Xirp2 APN 2 67508502 missense probably benign
IGL01724:Xirp2 APN 2 67526067 missense probably benign
IGL01739:Xirp2 APN 2 67515138 missense probably benign 0.15
IGL01807:Xirp2 APN 2 67515031 missense probably benign
IGL02006:Xirp2 APN 2 67511962 missense possibly damaging 0.85
IGL02030:Xirp2 APN 2 67508981 missense probably benign 0.06
IGL02066:Xirp2 APN 2 67526071 missense probably benign
IGL02138:Xirp2 APN 2 67516956 missense probably benign 0.15
IGL02250:Xirp2 APN 2 67514012 missense probably benign 0.03
IGL02265:Xirp2 APN 2 67517150 missense possibly damaging 0.94
IGL02274:Xirp2 APN 2 67508651 missense probably benign 0.12
IGL02322:Xirp2 APN 2 67508738 missense probably benign 0.00
IGL02327:Xirp2 APN 2 67510100 missense probably damaging 1.00
IGL02378:Xirp2 APN 2 67513768 missense probably benign 0.00
IGL02492:Xirp2 APN 2 67516167 missense probably damaging 0.99
IGL02549:Xirp2 APN 2 67513102 missense probably benign 0.03
IGL02578:Xirp2 APN 2 67511247 missense probably damaging 0.96
IGL02635:Xirp2 APN 2 67507910 missense possibly damaging 0.86
IGL02654:Xirp2 APN 2 67514671 missense possibly damaging 0.86
IGL02663:Xirp2 APN 2 67509458 missense possibly damaging 0.92
IGL02795:Xirp2 APN 2 67509136 missense probably damaging 1.00
IGL02934:Xirp2 APN 2 67515676 missense probably benign 0.33
IGL03003:Xirp2 APN 2 67515562 missense possibly damaging 0.93
IGL03069:Xirp2 APN 2 67509532 missense possibly damaging 0.91
IGL03286:Xirp2 APN 2 67516310 missense probably damaging 0.99
IGL03326:Xirp2 APN 2 67482246 missense probably benign 0.01
IGL03381:Xirp2 APN 2 67514226 missense probably benign 0.34
IGL03394:Xirp2 APN 2 67515194 missense probably damaging 0.99
3-1:Xirp2 UTSW 2 67508198 missense possibly damaging 0.95
H8562:Xirp2 UTSW 2 67515457 missense probably benign
PIT4142001:Xirp2 UTSW 2 67519362 splice site probably benign
PIT4260001:Xirp2 UTSW 2 67511597 missense possibly damaging 0.96
PIT4445001:Xirp2 UTSW 2 67509772 missense possibly damaging 0.84
PIT4531001:Xirp2 UTSW 2 67515482 missense possibly damaging 0.73
R0015:Xirp2 UTSW 2 67510899 nonsense probably null
R0063:Xirp2 UTSW 2 67509083 missense probably damaging 0.99
R0063:Xirp2 UTSW 2 67509083 missense probably damaging 0.99
R0066:Xirp2 UTSW 2 67512140 missense possibly damaging 0.85
R0109:Xirp2 UTSW 2 67519278 missense probably damaging 1.00
R0111:Xirp2 UTSW 2 67508378 missense probably damaging 0.99
R0115:Xirp2 UTSW 2 67509909 missense possibly damaging 0.92
R0117:Xirp2 UTSW 2 67517120 missense possibly damaging 0.94
R0133:Xirp2 UTSW 2 67517124 missense probably benign
R0282:Xirp2 UTSW 2 67513380 missense probably damaging 0.96
R0463:Xirp2 UTSW 2 67514918 missense probably benign 0.02
R0481:Xirp2 UTSW 2 67509909 missense possibly damaging 0.92
R0488:Xirp2 UTSW 2 67514821 missense possibly damaging 0.90
R0548:Xirp2 UTSW 2 67514414 missense probably benign 0.00
R0557:Xirp2 UTSW 2 67516351 missense probably benign 0.33
R0582:Xirp2 UTSW 2 67508866 missense probably benign
R0723:Xirp2 UTSW 2 67512215 missense probably damaging 0.98
R0835:Xirp2 UTSW 2 67507910 missense possibly damaging 0.86
R1160:Xirp2 UTSW 2 67509887 missense possibly damaging 0.92
R1189:Xirp2 UTSW 2 67513461 missense probably damaging 0.96
R1474:Xirp2 UTSW 2 67525067 missense probably benign 0.00
R1513:Xirp2 UTSW 2 67511530 missense probably benign 0.00
R1514:Xirp2 UTSW 2 67514323 nonsense probably null
R1519:Xirp2 UTSW 2 67515679 missense probably benign 0.44
R1532:Xirp2 UTSW 2 67513939 missense probably benign 0.00
R1537:Xirp2 UTSW 2 67510013 missense probably damaging 0.98
R1541:Xirp2 UTSW 2 67512290 missense possibly damaging 0.70
R1543:Xirp2 UTSW 2 67508039 missense probably benign
R1607:Xirp2 UTSW 2 67510295 nonsense probably null
R1620:Xirp2 UTSW 2 67510835 missense probably damaging 0.98
R1709:Xirp2 UTSW 2 67509871 missense probably benign 0.33
R1713:Xirp2 UTSW 2 67512418 missense probably benign 0.25
R1828:Xirp2 UTSW 2 67515238 missense possibly damaging 0.86
R1834:Xirp2 UTSW 2 67511140 missense probably damaging 0.99
R1905:Xirp2 UTSW 2 67516356 missense probably damaging 0.98
R1907:Xirp2 UTSW 2 67516356 missense probably damaging 0.98
R1943:Xirp2 UTSW 2 67512615 missense probably benign 0.34
R1971:Xirp2 UTSW 2 67511695 missense possibly damaging 0.48
R1998:Xirp2 UTSW 2 67509049 missense probably damaging 0.97
R2075:Xirp2 UTSW 2 67510201 missense probably benign 0.33
R2132:Xirp2 UTSW 2 67508048 missense possibly damaging 0.72
R2175:Xirp2 UTSW 2 67509914 missense probably damaging 0.99
R2310:Xirp2 UTSW 2 67526247 missense probably benign 0.19
R2338:Xirp2 UTSW 2 67510770 missense probably damaging 0.98
R2426:Xirp2 UTSW 2 67514471 missense probably benign 0.02
R2483:Xirp2 UTSW 2 67524992 missense probably benign
R3084:Xirp2 UTSW 2 67509049 missense probably damaging 0.97
R3113:Xirp2 UTSW 2 67510147 missense probably benign 0.33
R3903:Xirp2 UTSW 2 67508036 missense probably benign 0.40
R3916:Xirp2 UTSW 2 67511422 missense probably benign 0.25
R3928:Xirp2 UTSW 2 67511669 missense possibly damaging 0.85
R4025:Xirp2 UTSW 2 67511402 missense probably benign 0.12
R4135:Xirp2 UTSW 2 67525397 missense probably benign 0.00
R4223:Xirp2 UTSW 2 67516493 missense possibly damaging 0.66
R4257:Xirp2 UTSW 2 67516039 missense probably benign 0.31
R4499:Xirp2 UTSW 2 67513438 missense probably benign 0.08
R4577:Xirp2 UTSW 2 67513897 missense probably damaging 0.99
R4739:Xirp2 UTSW 2 67519265 missense probably damaging 0.99
R4758:Xirp2 UTSW 2 67516535 missense probably damaging 0.98
R4834:Xirp2 UTSW 2 67516406 missense probably benign 0.26
R4855:Xirp2 UTSW 2 67511064 missense possibly damaging 0.96
R4923:Xirp2 UTSW 2 67512893 missense probably benign
R4936:Xirp2 UTSW 2 67509819 missense possibly damaging 0.85
R5032:Xirp2 UTSW 2 67525670 missense possibly damaging 0.84
R5049:Xirp2 UTSW 2 67517134 missense probably benign 0.03
R5077:Xirp2 UTSW 2 67514477 missense probably benign
R5090:Xirp2 UTSW 2 67525470 missense possibly damaging 0.83
R5107:Xirp2 UTSW 2 67509710 missense probably damaging 0.99
R5107:Xirp2 UTSW 2 67511861 missense probably damaging 1.00
R5187:Xirp2 UTSW 2 67515367 missense probably benign 0.01
R5241:Xirp2 UTSW 2 67482360 nonsense probably null
R5307:Xirp2 UTSW 2 67511162 missense probably damaging 0.99
R5342:Xirp2 UTSW 2 67513461 missense probably damaging 0.96
R5370:Xirp2 UTSW 2 67512152 missense possibly damaging 0.72
R5375:Xirp2 UTSW 2 67511906 missense probably damaging 0.99
R5407:Xirp2 UTSW 2 67510969 missense probably benign 0.33
R5514:Xirp2 UTSW 2 67505121 missense probably benign 0.03
R5531:Xirp2 UTSW 2 67515302 missense probably benign 0.42
R5590:Xirp2 UTSW 2 67514035 missense probably benign 0.23
R5646:Xirp2 UTSW 2 67510790 missense probably damaging 0.99
R5649:Xirp2 UTSW 2 67516895 missense probably benign 0.00
R5686:Xirp2 UTSW 2 67482298 missense probably damaging 0.99
R5761:Xirp2 UTSW 2 67510967 missense probably benign 0.00
R5777:Xirp2 UTSW 2 67510004 missense possibly damaging 0.92
R5785:Xirp2 UTSW 2 67509662 missense probably damaging 0.96
R5843:Xirp2 UTSW 2 67476785 start gained probably benign
R5846:Xirp2 UTSW 2 67509243 missense probably damaging 0.98
R5875:Xirp2 UTSW 2 67505080 missense probably benign 0.00
R5896:Xirp2 UTSW 2 67508698 missense probably benign 0.32
R5896:Xirp2 UTSW 2 67509946 missense possibly damaging 0.91
R5901:Xirp2 UTSW 2 67513066 missense possibly damaging 0.91
R5934:Xirp2 UTSW 2 67524804 missense possibly damaging 0.92
R5950:Xirp2 UTSW 2 67511320 missense possibly damaging 0.95
R5996:Xirp2 UTSW 2 67511650 missense possibly damaging 0.91
R6013:Xirp2 UTSW 2 67510943 missense possibly damaging 0.48
R6048:Xirp2 UTSW 2 67508243 missense possibly damaging 0.96
R6111:Xirp2 UTSW 2 67511817 missense possibly damaging 0.86
R6180:Xirp2 UTSW 2 67505577 critical splice donor site probably null
R6342:Xirp2 UTSW 2 67511650 missense possibly damaging 0.91
R6346:Xirp2 UTSW 2 67516081 missense probably benign 0.00
R6603:Xirp2 UTSW 2 67516544 missense probably benign
R6604:Xirp2 UTSW 2 67509845 missense possibly damaging 0.86
R6669:Xirp2 UTSW 2 67513355 missense possibly damaging 0.78
R6701:Xirp2 UTSW 2 67516225 missense possibly damaging 0.94
R6726:Xirp2 UTSW 2 67512868 missense possibly damaging 0.88
R6833:Xirp2 UTSW 2 67509950 missense probably benign 0.12
R6897:Xirp2 UTSW 2 67508567 missense probably damaging 1.00
R6933:Xirp2 UTSW 2 67514857 missense probably benign 0.34
R7020:Xirp2 UTSW 2 67525569 missense probably benign
R7042:Xirp2 UTSW 2 67513289 missense probably benign 0.12
R7060:Xirp2 UTSW 2 67515608 missense probably damaging 1.00
R7179:Xirp2 UTSW 2 67509833 missense probably benign 0.00
R7229:Xirp2 UTSW 2 67525551 missense probably damaging 0.99
R7253:Xirp2 UTSW 2 67513482 missense probably benign
R7284:Xirp2 UTSW 2 67516829 missense probably benign
R7450:Xirp2 UTSW 2 67509815 missense possibly damaging 0.86
R7476:Xirp2 UTSW 2 67510634 missense probably benign 0.01
R7489:Xirp2 UTSW 2 67525560 missense possibly damaging 0.83
R7513:Xirp2 UTSW 2 67510764 missense possibly damaging 0.86
R7549:Xirp2 UTSW 2 67508897 missense possibly damaging 0.91
R7567:Xirp2 UTSW 2 67515982 missense probably benign 0.02
R7577:Xirp2 UTSW 2 67514965 missense possibly damaging 0.65
R7597:Xirp2 UTSW 2 67525755 missense possibly damaging 0.84
R7610:Xirp2 UTSW 2 67525962 missense possibly damaging 0.92
R7613:Xirp2 UTSW 2 67514498 missense probably benign 0.00
R7669:Xirp2 UTSW 2 67512177 missense probably benign 0.00
R7670:Xirp2 UTSW 2 67510573 missense possibly damaging 0.91
R7673:Xirp2 UTSW 2 67517087 missense probably damaging 1.00
R7682:Xirp2 UTSW 2 67508849 missense probably damaging 0.99
X0063:Xirp2 UTSW 2 67516123 missense probably benign 0.04
X0065:Xirp2 UTSW 2 67515118 missense probably benign 0.34
Z1088:Xirp2 UTSW 2 67513321 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TTTGAGACAACCCCACTCTATGC -3'
(R):5'- CAGAGTTGGTCATCAAGGAAGC -3'

Sequencing Primer
(F):5'- CACTCTATGCCATTCAAGATCATC -3'
(R):5'- TGGTCATCAAGGAAGCTTTTTC -3'
Posted On2019-10-17