Incidental Mutation 'R7563:Uncx'
ID585252
Institutional Source Beutler Lab
Gene Symbol Uncx
Ensembl Gene ENSMUSG00000029546
Gene NameUNC homeobox
SynonymsChx4, Uncx4.1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7563 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location139543494-139548179 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 139544506 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 113 (R113H)
Ref Sequence ENSEMBL: ENSMUSP00000134067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172997] [ENSMUST00000174792]
Predicted Effect probably damaging
Transcript: ENSMUST00000172997
AA Change: R113H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000134067
Gene: ENSMUSG00000029546
AA Change: R113H

DomainStartEndE-ValueType
low complexity region 8 13 N/A INTRINSIC
low complexity region 30 47 N/A INTRINSIC
low complexity region 110 138 N/A INTRINSIC
low complexity region 162 178 N/A INTRINSIC
low complexity region 184 207 N/A INTRINSIC
low complexity region 215 233 N/A INTRINSIC
low complexity region 239 251 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000174792
AA Change: R113H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139081
Gene: ENSMUSG00000029546
AA Change: R113H

DomainStartEndE-ValueType
HOX 109 164 1.9e-10 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mutants exhibit severe skeletal defects, including absence of pedicles, transverse processes and proximal ribs. Mutants die around birth from respiratory failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik A T 17: 23,717,328 F8L probably benign Het
Aadacl3 A G 4: 144,457,894 I98T probably damaging Het
Ahnak T C 19: 9,011,165 I3271T probably damaging Het
Aox1 G A 1: 58,047,145 V70I probably benign Het
Ap1g2 A G 14: 55,099,749 S710P probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Cacna1e T C 1: 154,471,416 K1064E probably benign Het
Capn11 T A 17: 45,633,965 I459F probably damaging Het
Ccnc A G 4: 21,732,220 I48V probably damaging Het
Ces1d T A 8: 93,178,039 I358F probably benign Het
Clgn A T 8: 83,420,556 N379I probably damaging Het
Cym T C 3: 107,214,232 Y248C probably damaging Het
Epha8 T C 4: 136,938,789 D352G possibly damaging Het
Eya2 T C 2: 165,716,130 probably null Het
Fbxl5 C T 5: 43,821,549 V20I probably benign Het
Fscb T C 12: 64,473,285 E469G possibly damaging Het
Glt8d2 A T 10: 82,660,825 probably null Het
Gm13088 A T 4: 143,654,105 Y449* probably null Het
Helt T C 8: 46,293,593 probably benign Het
Igkv8-27 G T 6: 70,171,903 T89K probably benign Het
Ipo5 T A 14: 120,946,155 H1048Q probably benign Het
Kalrn T C 16: 34,392,094 D28G probably damaging Het
Kcnh4 G A 11: 100,741,854 P936S probably benign Het
Klrd1 A G 6: 129,593,738 I37M possibly damaging Het
Kmt2e T C 5: 23,500,273 V1267A probably damaging Het
Lrrc29 A G 8: 105,315,756 C147R probably benign Het
March1 A T 8: 66,468,313 Q214L probably damaging Het
Mlip G T 9: 77,112,997 H52N probably damaging Het
Oas1e T C 5: 120,788,956 R229G probably benign Het
Ogfr T A 2: 180,592,507 probably null Het
Olfr1023 T A 2: 85,887,138 Y113N probably damaging Het
Olfr1279 T C 2: 111,306,789 F195L probably benign Het
Pde4d T C 13: 109,951,007 I636T probably benign Het
Pex5l C T 3: 32,954,476 V426I probably damaging Het
Pmfbp1 A G 8: 109,525,374 K384E possibly damaging Het
Prl6a1 T G 13: 27,314,238 probably null Het
Prss23 A T 7: 89,509,830 W344R probably damaging Het
Ptar1 T A 19: 23,720,316 D397E probably benign Het
Qrsl1 G A 10: 43,876,517 R437C probably damaging Het
Rab6a G T 7: 100,608,197 probably benign Het
Samd14 C A 11: 95,021,413 S205R probably benign Het
Sel1l3 T C 5: 53,185,984 Y322C probably damaging Het
Slc30a5 A T 13: 100,803,972 L669I probably benign Het
Ssc4d A G 5: 135,963,033 L419P probably damaging Het
Tbc1d2b A T 9: 90,219,010 Y642* probably null Het
Tbc1d2b A C 9: 90,226,248 F417V probably benign Het
Top2a T C 11: 99,016,179 D212G probably damaging Het
Trim39 A T 17: 36,260,915 V317E probably damaging Het
Usp4 A G 9: 108,379,344 S655G probably benign Het
Vmn2r114 C T 17: 23,291,026 V827I probably benign Het
Vmn2r28 T A 7: 5,488,201 N349I probably benign Het
Vmn2r3 A G 3: 64,275,349 W310R possibly damaging Het
Xirp2 T C 2: 67,509,901 W829R probably damaging Het
Zfp574 C A 7: 25,081,352 H600N possibly damaging Het
Other mutations in Uncx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02616:Uncx APN 5 139546768 missense possibly damaging 0.95
PIT4378001:Uncx UTSW 5 139544622 nonsense probably null
R0658:Uncx UTSW 5 139544187 missense probably damaging 0.99
R0959:Uncx UTSW 5 139546687 missense probably damaging 1.00
R1786:Uncx UTSW 5 139547547 missense probably benign 0.00
R3870:Uncx UTSW 5 139547365 missense probably damaging 0.98
R4022:Uncx UTSW 5 139546689 missense probably damaging 0.97
R4512:Uncx UTSW 5 139546767 missense possibly damaging 0.59
R4514:Uncx UTSW 5 139546767 missense possibly damaging 0.59
R4604:Uncx UTSW 5 139544082 missense possibly damaging 0.95
R4864:Uncx UTSW 5 139544120 missense probably damaging 0.98
R5048:Uncx UTSW 5 139547119 missense probably benign 0.00
R5408:Uncx UTSW 5 139544490 nonsense probably null
R5954:Uncx UTSW 5 139547629 missense probably benign
R5997:Uncx UTSW 5 139547589 missense probably damaging 1.00
R7477:Uncx UTSW 5 139547262 missense probably benign
R7598:Uncx UTSW 5 139544054 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TCAAGCTTGCAGGTAGGCTG -3'
(R):5'- TTAGAACAAAGGTGGCCCTG -3'

Sequencing Primer
(F):5'- CTTGCAGGTAGGCTGGAGGC -3'
(R):5'- TGCCTCACCGCGCTCTG -3'
Posted On2019-10-17