Incidental Mutation 'R0619:BC037034'
ID58526
Institutional Source Beutler Lab
Gene Symbol BC037034
Ensembl Gene ENSMUSG00000036948
Gene NamecDNA sequence BC037034
Synonyms
MMRRC Submission 038808-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R0619 (G1)
Quality Score220
Status Not validated
Chromosome5
Chromosomal Location138259656-138264033 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 138263826 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048421] [ENSMUST00000062067] [ENSMUST00000100530] [ENSMUST00000159067] [ENSMUST00000159123] [ENSMUST00000159146] [ENSMUST00000159649] [ENSMUST00000161279] [ENSMUST00000161647]
Predicted Effect unknown
Transcript: ENSMUST00000048421
AA Change: S3P
SMART Domains Protein: ENSMUSP00000046898
Gene: ENSMUSG00000036948
AA Change: S3P

DomainStartEndE-ValueType
low complexity region 53 71 N/A INTRINSIC
low complexity region 75 93 N/A INTRINSIC
low complexity region 95 114 N/A INTRINSIC
low complexity region 215 225 N/A INTRINSIC
low complexity region 488 502 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000062067
Predicted Effect probably benign
Transcript: ENSMUST00000100530
SMART Domains Protein: ENSMUSP00000098099
Gene: ENSMUSG00000075593

DomainStartEndE-ValueType
Pfam:Gal-3-0_sulfotr 2 231 1.1e-57 PFAM
Pfam:Gal-3-0_sulfotr 270 463 1e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124298
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125662
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138911
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141454
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144460
Predicted Effect probably benign
Transcript: ENSMUST00000159067
SMART Domains Protein: ENSMUSP00000125178
Gene: ENSMUSG00000106247

DomainStartEndE-ValueType
Pfam:Glypican 7 250 1e-90 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000159123
AA Change: S3P
SMART Domains Protein: ENSMUSP00000137679
Gene: ENSMUSG00000036948
AA Change: S3P

DomainStartEndE-ValueType
low complexity region 53 71 N/A INTRINSIC
low complexity region 75 93 N/A INTRINSIC
low complexity region 95 114 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159146
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159534
Predicted Effect probably benign
Transcript: ENSMUST00000159649
SMART Domains Protein: ENSMUSP00000125208
Gene: ENSMUSG00000036948

DomainStartEndE-ValueType
low complexity region 219 233 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159872
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160157
Predicted Effect probably benign
Transcript: ENSMUST00000161279
SMART Domains Protein: ENSMUSP00000124841
Gene: ENSMUSG00000075593

DomainStartEndE-ValueType
Pfam:Gal-3-0_sulfotr 2 231 1.1e-57 PFAM
Pfam:Gal-3-0_sulfotr 270 463 1e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161647
SMART Domains Protein: ENSMUSP00000125084
Gene: ENSMUSG00000075593

DomainStartEndE-ValueType
Pfam:Gal-3-0_sulfotr 4 226 5.3e-58 PFAM
Pfam:Gal-3-0_sulfotr 265 458 3.8e-55 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162557
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162632
Predicted Effect unknown
Transcript: ENSMUST00000164203
AA Change: S3P
SMART Domains Protein: ENSMUSP00000127440
Gene: ENSMUSG00000091964
AA Change: S3P

DomainStartEndE-ValueType
low complexity region 53 71 N/A INTRINSIC
low complexity region 75 93 N/A INTRINSIC
low complexity region 95 114 N/A INTRINSIC
Pfam:DUF4707 139 579 4.7e-252 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170479
AA Change: S70P
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adad2 G A 8: 119,613,000 D74N probably benign Het
Adgre4 T A 17: 55,820,679 V573D possibly damaging Het
Ak7 A G 12: 105,733,511 K230E probably damaging Het
Amdhd2 T C 17: 24,156,588 D375G possibly damaging Het
Anpep T C 7: 79,841,009 E253G probably benign Het
Bbs7 A G 3: 36,607,576 L158S probably benign Het
Bdp1 T C 13: 100,037,858 T2057A probably benign Het
C2 G T 17: 34,872,503 H61Q probably damaging Het
Ccdc18 A G 5: 108,180,416 K661E probably benign Het
Cdh23 C T 10: 60,433,777 V655I probably damaging Het
Cep78 T C 19: 15,978,862 T238A probably damaging Het
Ces2a T A 8: 104,736,110 N110K probably benign Het
Crat T C 2: 30,409,984 D128G probably benign Het
Dclre1a A T 19: 56,545,409 M233K probably benign Het
Dsg4 T C 18: 20,461,359 V515A probably benign Het
Fer1l6 T C 15: 58,662,935 probably null Het
Fryl T C 5: 73,068,731 D1863G probably benign Het
Fsip2 T A 2: 82,944,140 L57Q probably damaging Het
Gnb4 C T 3: 32,591,207 V112I probably benign Het
Iqsec1 T C 6: 90,670,406 probably null Het
Kcnn3 A C 3: 89,652,030 T536P probably damaging Het
Kctd3 T C 1: 188,978,643 D441G probably damaging Het
Kifc3 G A 8: 95,102,665 T528M probably benign Het
Kmt2c G A 5: 25,298,916 T3798I probably benign Het
Map1a T A 2: 121,305,255 M1946K probably damaging Het
Mfhas1 T A 8: 35,590,675 V768E probably benign Het
Mroh8 C A 2: 157,265,081 V223F possibly damaging Het
Mss51 A T 14: 20,487,573 V30E probably benign Het
Mtmr10 G A 7: 64,321,213 R392H probably benign Het
Mup3 T C 4: 62,085,961 N105S probably benign Het
Myh7b T C 2: 155,611,722 M22T probably benign Het
Olfr1034 T A 2: 86,047,311 Y276* probably null Het
Olfr170 T A 16: 19,606,272 Y132F probably damaging Het
Olfr97 T A 17: 37,232,155 I72F possibly damaging Het
Os9 A G 10: 127,120,991 I43T probably damaging Het
Pkhd1l1 T C 15: 44,483,838 L200P probably damaging Het
Ptpru C T 4: 131,820,887 V100M possibly damaging Het
Rnf6 G A 5: 146,210,721 R496C possibly damaging Het
Rsad1 C T 11: 94,542,639 R407Q probably damaging Het
Rspo3 T C 10: 29,504,637 D127G probably damaging Het
Sbf2 T A 7: 110,310,262 T1760S possibly damaging Het
Sh2d3c T A 2: 32,753,025 V588E probably damaging Het
Siglech A T 7: 55,769,162 T238S probably benign Het
Slc15a2 T A 16: 36,759,307 N328I probably damaging Het
Slc16a11 G T 11: 70,215,032 G94C probably damaging Het
Stub1 T C 17: 25,831,322 probably null Het
Tacc2 T A 7: 130,716,753 V40D probably damaging Het
Tagln3 C A 16: 45,724,272 R12L probably damaging Het
Tsen54 A G 11: 115,815,064 E69G probably damaging Het
Tsks A G 7: 44,950,834 E150G probably damaging Het
Ubap2l A C 3: 90,017,220 V680G probably benign Het
Usp16 A T 16: 87,472,164 H315L probably benign Het
Vav2 A G 2: 27,296,121 probably null Het
Zfc3h1 T C 10: 115,420,810 F1562L possibly damaging Het
Zfp764 C A 7: 127,406,541 V22L probably benign Het
Other mutations in BC037034
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00517:BC037034 APN 5 138261705 missense possibly damaging 0.46
IGL01617:BC037034 APN 5 138262216 missense probably damaging 1.00
IGL02256:BC037034 APN 5 138260315 missense probably damaging 0.99
IGL02493:BC037034 APN 5 138263170 unclassified probably null
IGL02904:BC037034 APN 5 138260602 missense probably benign 0.04
IGL03151:BC037034 APN 5 138262672 missense possibly damaging 0.95
R0005:BC037034 UTSW 5 138262654 splice site probably null
R0010:BC037034 UTSW 5 138260293 unclassified probably null
R0010:BC037034 UTSW 5 138260293 unclassified probably null
R0630:BC037034 UTSW 5 138262289 missense probably damaging 0.98
R1579:BC037034 UTSW 5 138261866 missense probably benign 0.00
R1778:BC037034 UTSW 5 138262477 unclassified probably null
R1816:BC037034 UTSW 5 138260341 missense possibly damaging 0.91
R2009:BC037034 UTSW 5 138260929 missense probably damaging 1.00
R4711:BC037034 UTSW 5 138262905 unclassified probably benign
R4923:BC037034 UTSW 5 138262379 unclassified probably benign
R4999:BC037034 UTSW 5 138261622 missense probably damaging 1.00
R5103:BC037034 UTSW 5 138262300 missense probably benign 0.15
R5221:BC037034 UTSW 5 138262240 missense probably benign 0.14
R5444:BC037034 UTSW 5 138260998 unclassified probably null
R5720:BC037034 UTSW 5 138263702 missense probably benign 0.00
R6519:BC037034 UTSW 5 138261848 missense probably damaging 0.99
R6599:BC037034 UTSW 5 138263458 unclassified probably null
R6918:BC037034 UTSW 5 138260664 missense probably benign 0.03
R7275:BC037034 UTSW 5 138263577 missense probably benign 0.18
R7460:BC037034 UTSW 5 138262729 missense probably benign 0.32
R7564:BC037034 UTSW 5 138262842 splice site probably null
Predicted Primers PCR Primer
(F):5'- TGTCACCCAGAGATCCTCACCG -3'
(R):5'- CCTTAAAGGTTCCTCAGCAGCCC -3'

Sequencing Primer
(F):5'- GGGCTGCAACCTCGAAAC -3'
(R):5'- TCAGCCAAGAAGCCTCGG -3'
Posted On2013-07-11