Incidental Mutation 'R7563:Clgn'
ID585262
Institutional Source Beutler Lab
Gene Symbol Clgn
Ensembl Gene ENSMUSG00000002190
Gene Namecalmegin
Synonyms4930459O04Rik, A2/6, Cln, calnexin-t
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.350) question?
Stock #R7563 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location83389867-83428552 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 83420556 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 379 (N379I)
Ref Sequence ENSEMBL: ENSMUSP00000002259 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002259] [ENSMUST00000109831]
Predicted Effect probably damaging
Transcript: ENSMUST00000002259
AA Change: N379I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002259
Gene: ENSMUSG00000002190
AA Change: N379I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Calreticulin 62 429 6.6e-160 PFAM
transmembrane domain 471 493 N/A INTRINSIC
low complexity region 516 533 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109831
AA Change: N379I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105457
Gene: ENSMUSG00000002190
AA Change: N379I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Calreticulin 60 429 1.9e-154 PFAM
transmembrane domain 471 493 N/A INTRINSIC
low complexity region 516 533 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene belongs to the calreticulin family, which includes calreticulin, calnexin, and calmegin, and encodes a calcium-binding molecular chaperone specifically expressed in pachytene stage male germ cells. It is required for the proper folding of newly synthesized membrane proteins in the endoplasmic reticulum including those critical for sperm migration from the uterus into the oviduct and sperm adhesion to and penetration of the zona pellucida. This gene plays a key role in spermatogenesis and male infertility. Alternative splice variants exist for this gene. [provided by RefSeq, Jul 2016]
PHENOTYPE: Males homozygous for a targeted null mutation exhibit severely impaired fertility associated with an apparent defect in either sperm/zona pellucida binding and/or sperm transit to the oviduct. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik A T 17: 23,717,328 F8L probably benign Het
Aadacl3 A G 4: 144,457,894 I98T probably damaging Het
Ahnak T C 19: 9,011,165 I3271T probably damaging Het
Aox1 G A 1: 58,047,145 V70I probably benign Het
Ap1g2 A G 14: 55,099,749 S710P probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Cacna1e T C 1: 154,471,416 K1064E probably benign Het
Capn11 T A 17: 45,633,965 I459F probably damaging Het
Ccnc A G 4: 21,732,220 I48V probably damaging Het
Ces1d T A 8: 93,178,039 I358F probably benign Het
Cym T C 3: 107,214,232 Y248C probably damaging Het
Epha8 T C 4: 136,938,789 D352G possibly damaging Het
Eya2 T C 2: 165,716,130 probably null Het
Fbxl5 C T 5: 43,821,549 V20I probably benign Het
Fscb T C 12: 64,473,285 E469G possibly damaging Het
Glt8d2 A T 10: 82,660,825 probably null Het
Gm13088 A T 4: 143,654,105 Y449* probably null Het
Helt T C 8: 46,293,593 probably benign Het
Igkv8-27 G T 6: 70,171,903 T89K probably benign Het
Ipo5 T A 14: 120,946,155 H1048Q probably benign Het
Kalrn T C 16: 34,392,094 D28G probably damaging Het
Kcnh4 G A 11: 100,741,854 P936S probably benign Het
Klrd1 A G 6: 129,593,738 I37M possibly damaging Het
Kmt2e T C 5: 23,500,273 V1267A probably damaging Het
Lrrc29 A G 8: 105,315,756 C147R probably benign Het
March1 A T 8: 66,468,313 Q214L probably damaging Het
Mlip G T 9: 77,112,997 H52N probably damaging Het
Oas1e T C 5: 120,788,956 R229G probably benign Het
Ogfr T A 2: 180,592,507 probably null Het
Olfr1023 T A 2: 85,887,138 Y113N probably damaging Het
Olfr1279 T C 2: 111,306,789 F195L probably benign Het
Pde4d T C 13: 109,951,007 I636T probably benign Het
Pex5l C T 3: 32,954,476 V426I probably damaging Het
Pmfbp1 A G 8: 109,525,374 K384E possibly damaging Het
Prl6a1 T G 13: 27,314,238 probably null Het
Prss23 A T 7: 89,509,830 W344R probably damaging Het
Ptar1 T A 19: 23,720,316 D397E probably benign Het
Qrsl1 G A 10: 43,876,517 R437C probably damaging Het
Rab6a G T 7: 100,608,197 probably benign Het
Samd14 C A 11: 95,021,413 S205R probably benign Het
Sel1l3 T C 5: 53,185,984 Y322C probably damaging Het
Slc30a5 A T 13: 100,803,972 L669I probably benign Het
Ssc4d A G 5: 135,963,033 L419P probably damaging Het
Tbc1d2b A T 9: 90,219,010 Y642* probably null Het
Tbc1d2b A C 9: 90,226,248 F417V probably benign Het
Top2a T C 11: 99,016,179 D212G probably damaging Het
Trim39 A T 17: 36,260,915 V317E probably damaging Het
Uncx G A 5: 139,544,506 R113H probably damaging Het
Usp4 A G 9: 108,379,344 S655G probably benign Het
Vmn2r114 C T 17: 23,291,026 V827I probably benign Het
Vmn2r28 T A 7: 5,488,201 N349I probably benign Het
Vmn2r3 A G 3: 64,275,349 W310R possibly damaging Het
Xirp2 T C 2: 67,509,901 W829R probably damaging Het
Zfp574 C A 7: 25,081,352 H600N possibly damaging Het
Other mutations in Clgn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01729:Clgn APN 8 83397650 missense probably damaging 1.00
IGL02158:Clgn APN 8 83423136 missense probably damaging 1.00
IGL03077:Clgn APN 8 83424140 missense probably benign 0.05
PIT4260001:Clgn UTSW 8 83423124 missense probably damaging 0.99
R0604:Clgn UTSW 8 83424194 missense probably benign 0.01
R1728:Clgn UTSW 8 83423030 missense probably damaging 0.98
R1729:Clgn UTSW 8 83423030 missense probably damaging 0.98
R2059:Clgn UTSW 8 83399978 missense probably benign 0.01
R2182:Clgn UTSW 8 83410410 missense possibly damaging 0.80
R3821:Clgn UTSW 8 83420477 missense probably null 0.02
R4542:Clgn UTSW 8 83420209 missense probably damaging 1.00
R5097:Clgn UTSW 8 83410523 missense possibly damaging 0.90
R5677:Clgn UTSW 8 83409538 missense probably damaging 1.00
R5752:Clgn UTSW 8 83397041 missense probably damaging 0.99
R5802:Clgn UTSW 8 83425614 missense probably damaging 1.00
R6584:Clgn UTSW 8 83400036 missense probably benign 0.33
R7542:Clgn UTSW 8 83395545 missense possibly damaging 0.90
R7819:Clgn UTSW 8 83408200 missense possibly damaging 0.87
RF022:Clgn UTSW 8 83425606 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTCCTTAGTTTCACGAGGTGCC -3'
(R):5'- CCAAGTGCTGGGATTAAAGGC -3'

Sequencing Primer
(F):5'- TCACGAGGTGCCAAGTGTATC -3'
(R):5'- CTGGGATTAAAGGCGTGCGC -3'
Posted On2019-10-17