Incidental Mutation 'R7563:Samd14'
ID585271
Institutional Source Beutler Lab
Gene Symbol Samd14
Ensembl Gene ENSMUSG00000047181
Gene Namesterile alpha motif domain containing 14
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.174) question?
Stock #R7563 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location95009879-95026087 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 95021413 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 205 (S205R)
Ref Sequence ENSEMBL: ENSMUSP00000062231 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038431] [ENSMUST00000055947] [ENSMUST00000124735]
Predicted Effect probably benign
Transcript: ENSMUST00000038431
SMART Domains Protein: ENSMUSP00000041447
Gene: ENSMUSG00000038967

DomainStartEndE-ValueType
Pfam:BCDHK_Adom3 30 192 3.8e-52 PFAM
HATPase_c 240 364 9.32e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000055947
AA Change: S205R

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000062231
Gene: ENSMUSG00000047181
AA Change: S205R

DomainStartEndE-ValueType
low complexity region 42 57 N/A INTRINSIC
low complexity region 138 153 N/A INTRINSIC
low complexity region 244 260 N/A INTRINSIC
low complexity region 276 289 N/A INTRINSIC
SAM 323 389 7.96e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124735
SMART Domains Protein: ENSMUSP00000123361
Gene: ENSMUSG00000047181

DomainStartEndE-ValueType
SCOP:d1jj2w_ 21 62 1e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik A T 17: 23,717,328 F8L probably benign Het
Aadacl3 A G 4: 144,457,894 I98T probably damaging Het
Ahnak T C 19: 9,011,165 I3271T probably damaging Het
Aox1 G A 1: 58,047,145 V70I probably benign Het
Ap1g2 A G 14: 55,099,749 S710P probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Cacna1e T C 1: 154,471,416 K1064E probably benign Het
Capn11 T A 17: 45,633,965 I459F probably damaging Het
Ccnc A G 4: 21,732,220 I48V probably damaging Het
Ces1d T A 8: 93,178,039 I358F probably benign Het
Clgn A T 8: 83,420,556 N379I probably damaging Het
Cym T C 3: 107,214,232 Y248C probably damaging Het
Epha8 T C 4: 136,938,789 D352G possibly damaging Het
Eya2 T C 2: 165,716,130 probably null Het
Fbxl5 C T 5: 43,821,549 V20I probably benign Het
Fscb T C 12: 64,473,285 E469G possibly damaging Het
Glt8d2 A T 10: 82,660,825 probably null Het
Gm13088 A T 4: 143,654,105 Y449* probably null Het
Helt T C 8: 46,293,593 probably benign Het
Igkv8-27 G T 6: 70,171,903 T89K probably benign Het
Ipo5 T A 14: 120,946,155 H1048Q probably benign Het
Kalrn T C 16: 34,392,094 D28G probably damaging Het
Kcnh4 G A 11: 100,741,854 P936S probably benign Het
Klrd1 A G 6: 129,593,738 I37M possibly damaging Het
Kmt2e T C 5: 23,500,273 V1267A probably damaging Het
Lrrc29 A G 8: 105,315,756 C147R probably benign Het
March1 A T 8: 66,468,313 Q214L probably damaging Het
Mlip G T 9: 77,112,997 H52N probably damaging Het
Oas1e T C 5: 120,788,956 R229G probably benign Het
Ogfr T A 2: 180,592,507 probably null Het
Olfr1023 T A 2: 85,887,138 Y113N probably damaging Het
Olfr1279 T C 2: 111,306,789 F195L probably benign Het
Pde4d T C 13: 109,951,007 I636T probably benign Het
Pex5l C T 3: 32,954,476 V426I probably damaging Het
Pmfbp1 A G 8: 109,525,374 K384E possibly damaging Het
Prl6a1 T G 13: 27,314,238 probably null Het
Prss23 A T 7: 89,509,830 W344R probably damaging Het
Ptar1 T A 19: 23,720,316 D397E probably benign Het
Qrsl1 G A 10: 43,876,517 R437C probably damaging Het
Rab6a G T 7: 100,608,197 probably benign Het
Sel1l3 T C 5: 53,185,984 Y322C probably damaging Het
Slc30a5 A T 13: 100,803,972 L669I probably benign Het
Ssc4d A G 5: 135,963,033 L419P probably damaging Het
Tbc1d2b A T 9: 90,219,010 Y642* probably null Het
Tbc1d2b A C 9: 90,226,248 F417V probably benign Het
Top2a T C 11: 99,016,179 D212G probably damaging Het
Trim39 A T 17: 36,260,915 V317E probably damaging Het
Uncx G A 5: 139,544,506 R113H probably damaging Het
Usp4 A G 9: 108,379,344 S655G probably benign Het
Vmn2r114 C T 17: 23,291,026 V827I probably benign Het
Vmn2r28 T A 7: 5,488,201 N349I probably benign Het
Vmn2r3 A G 3: 64,275,349 W310R possibly damaging Het
Xirp2 T C 2: 67,509,901 W829R probably damaging Het
Zfp574 C A 7: 25,081,352 H600N possibly damaging Het
Other mutations in Samd14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01071:Samd14 APN 11 95021468 unclassified probably benign
IGL01466:Samd14 APN 11 95023255 unclassified probably benign
IGL02212:Samd14 APN 11 95023350 missense probably damaging 0.98
R1835:Samd14 UTSW 11 95023600 missense probably damaging 1.00
R2004:Samd14 UTSW 11 95023284 missense probably damaging 0.99
R2172:Samd14 UTSW 11 95014391 missense probably benign
R4584:Samd14 UTSW 11 95021535 splice site probably null
R5133:Samd14 UTSW 11 95021583 missense probably damaging 0.98
R6852:Samd14 UTSW 11 95021454 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTAAAGATGACAGCCGGGATGC -3'
(R):5'- CTGTCCGTGAACCAGGAAAAG -3'

Sequencing Primer
(F):5'- TGCCAGCCCCACCATCG -3'
(R):5'- CAGGAACGGGGAGCTTCCTG -3'
Posted On2019-10-17