Incidental Mutation 'R7563:Kcnh4'
ID585273
Institutional Source Beutler Lab
Gene Symbol Kcnh4
Ensembl Gene ENSMUSG00000035355
Gene Namepotassium voltage-gated channel, subfamily H (eag-related), member 4
SynonymsBEC2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7563 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location100740376-100759942 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 100741854 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 936 (P936S)
Ref Sequence ENSEMBL: ENSMUSP00000102984 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019317] [ENSMUST00000107361] [ENSMUST00000107363] [ENSMUST00000107364] [ENSMUST00000155500]
Predicted Effect probably benign
Transcript: ENSMUST00000019317
SMART Domains Protein: ENSMUSP00000019317
Gene: ENSMUSG00000019173

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
RAB 22 203 6.29e-85 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107361
AA Change: P936S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000102984
Gene: ENSMUSG00000035355
AA Change: P936S

DomainStartEndE-ValueType
PAS 16 88 1.41e-1 SMART
PAC 94 136 4.88e-5 SMART
low complexity region 155 168 N/A INTRINSIC
Pfam:Ion_trans 226 486 1.5e-32 PFAM
Pfam:Ion_trans_2 412 480 2.3e-12 PFAM
cNMP 556 681 1.27e-12 SMART
low complexity region 726 735 N/A INTRINSIC
low complexity region 766 787 N/A INTRINSIC
coiled coil region 874 911 N/A INTRINSIC
low complexity region 981 1006 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107363
AA Change: P936S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000102986
Gene: ENSMUSG00000035355
AA Change: P936S

DomainStartEndE-ValueType
PAS 16 88 1.41e-1 SMART
PAC 94 136 4.88e-5 SMART
low complexity region 155 168 N/A INTRINSIC
transmembrane domain 228 250 N/A INTRINSIC
Pfam:Ion_trans 265 474 1.1e-17 PFAM
Pfam:Ion_trans_2 412 480 2.2e-12 PFAM
cNMP 556 681 1.27e-12 SMART
low complexity region 726 735 N/A INTRINSIC
low complexity region 766 787 N/A INTRINSIC
coiled coil region 874 911 N/A INTRINSIC
low complexity region 981 1006 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107364
SMART Domains Protein: ENSMUSP00000102987
Gene: ENSMUSG00000019173

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
RAB 22 185 3.37e-94 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155500
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily H. This member is a pore-forming (alpha) subunit. The gene is brain-specific, and located in the neocortex and the striatum. It may be involved in cellular excitability of restricted neurons in the central nervous system. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik A T 17: 23,717,328 F8L probably benign Het
Aadacl3 A G 4: 144,457,894 I98T probably damaging Het
Ahnak T C 19: 9,011,165 I3271T probably damaging Het
Aox1 G A 1: 58,047,145 V70I probably benign Het
Ap1g2 A G 14: 55,099,749 S710P probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Cacna1e T C 1: 154,471,416 K1064E probably benign Het
Capn11 T A 17: 45,633,965 I459F probably damaging Het
Ccnc A G 4: 21,732,220 I48V probably damaging Het
Ces1d T A 8: 93,178,039 I358F probably benign Het
Clgn A T 8: 83,420,556 N379I probably damaging Het
Cym T C 3: 107,214,232 Y248C probably damaging Het
Epha8 T C 4: 136,938,789 D352G possibly damaging Het
Eya2 T C 2: 165,716,130 probably null Het
Fam219a A C 4: 41,569,208 V10G probably benign Het
Fbxl5 C T 5: 43,821,549 V20I probably benign Het
Fscb T C 12: 64,473,285 E469G possibly damaging Het
Glt8d2 A T 10: 82,660,825 probably null Het
Gm13088 A T 4: 143,654,105 Y449* probably null Het
Helt T C 8: 46,293,593 probably benign Het
Igkv8-27 G T 6: 70,171,903 T89K probably benign Het
Ipo5 T A 14: 120,946,155 H1048Q probably benign Het
Kalrn T C 16: 34,392,094 D28G probably damaging Het
Klrd1 A G 6: 129,593,738 I37M possibly damaging Het
Kmt2e T C 5: 23,500,273 V1267A probably damaging Het
Lrrc29 A G 8: 105,315,756 C147R probably benign Het
March1 A T 8: 66,468,313 Q214L probably damaging Het
Mlip G T 9: 77,112,997 H52N probably damaging Het
Oas1e T C 5: 120,788,956 R229G probably benign Het
Ogfr T A 2: 180,592,507 probably null Het
Olfr1023 T A 2: 85,887,138 Y113N probably damaging Het
Olfr1279 T C 2: 111,306,789 F195L probably benign Het
Pde4d T C 13: 109,951,007 I636T probably benign Het
Pex5l C T 3: 32,954,476 V426I probably damaging Het
Pmfbp1 A G 8: 109,525,374 K384E possibly damaging Het
Prl6a1 T G 13: 27,314,238 probably null Het
Prss23 A T 7: 89,509,830 W344R probably damaging Het
Ptar1 T A 19: 23,720,316 D397E probably benign Het
Qrsl1 G A 10: 43,876,517 R437C probably damaging Het
Rab6a G T 7: 100,608,197 probably benign Het
Samd14 C A 11: 95,021,413 S205R probably benign Het
Sel1l3 T C 5: 53,185,984 Y322C probably damaging Het
Slc30a5 A T 13: 100,803,972 L669I probably benign Het
Ssc4d A G 5: 135,963,033 L419P probably damaging Het
Tbc1d2b A T 9: 90,219,010 Y642* probably null Het
Tbc1d2b A C 9: 90,226,248 F417V probably benign Het
Top2a T C 11: 99,016,179 D212G probably damaging Het
Trim39 A T 17: 36,260,915 V317E probably damaging Het
Uncx G A 5: 139,544,506 R113H probably damaging Het
Usp4 A G 9: 108,379,344 S655G probably benign Het
Vmn2r114 C T 17: 23,291,026 V827I probably benign Het
Vmn2r28 T A 7: 5,488,201 N349I probably benign Het
Vmn2r3 A G 3: 64,275,349 W310R possibly damaging Het
Xirp2 T C 2: 67,509,901 W829R probably damaging Het
Zfp574 C A 7: 25,081,352 H600N possibly damaging Het
Other mutations in Kcnh4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Kcnh4 APN 11 100756995 splice site probably benign
IGL00430:Kcnh4 APN 11 100757654 missense possibly damaging 0.85
IGL02031:Kcnh4 APN 11 100745823 missense probably damaging 1.00
IGL02346:Kcnh4 APN 11 100756942 missense possibly damaging 0.46
IGL02674:Kcnh4 APN 11 100746894 missense possibly damaging 0.58
IGL02903:Kcnh4 APN 11 100757654 missense possibly damaging 0.50
IGL03152:Kcnh4 APN 11 100745772 missense probably benign 0.00
R0032:Kcnh4 UTSW 11 100746932 missense probably benign 0.19
R0033:Kcnh4 UTSW 11 100746932 missense probably benign 0.19
R0066:Kcnh4 UTSW 11 100757800 missense probably benign 0.11
R0066:Kcnh4 UTSW 11 100757800 missense probably benign 0.11
R0242:Kcnh4 UTSW 11 100755699 missense probably damaging 1.00
R0242:Kcnh4 UTSW 11 100755699 missense probably damaging 1.00
R0244:Kcnh4 UTSW 11 100746932 missense probably benign 0.19
R0310:Kcnh4 UTSW 11 100746169 missense probably benign 0.04
R0330:Kcnh4 UTSW 11 100757743 missense probably damaging 1.00
R0345:Kcnh4 UTSW 11 100757681 missense probably benign 0.08
R0436:Kcnh4 UTSW 11 100746932 missense probably benign 0.19
R0466:Kcnh4 UTSW 11 100746932 missense probably benign 0.19
R0468:Kcnh4 UTSW 11 100746932 missense probably benign 0.19
R0487:Kcnh4 UTSW 11 100750258 missense probably damaging 0.99
R0562:Kcnh4 UTSW 11 100750244 missense possibly damaging 0.80
R0613:Kcnh4 UTSW 11 100746932 missense probably benign 0.19
R1077:Kcnh4 UTSW 11 100752338 missense possibly damaging 0.72
R1705:Kcnh4 UTSW 11 100741772 missense probably benign
R1840:Kcnh4 UTSW 11 100745341 missense possibly damaging 0.46
R2114:Kcnh4 UTSW 11 100759595 missense probably damaging 1.00
R4448:Kcnh4 UTSW 11 100755907 missense probably benign 0.00
R4823:Kcnh4 UTSW 11 100755174 missense probably damaging 1.00
R4865:Kcnh4 UTSW 11 100749743 missense probably damaging 1.00
R4963:Kcnh4 UTSW 11 100752253 missense probably damaging 1.00
R4977:Kcnh4 UTSW 11 100746833 missense probably damaging 1.00
R5228:Kcnh4 UTSW 11 100746896 missense probably damaging 1.00
R5385:Kcnh4 UTSW 11 100752250 missense probably damaging 1.00
R5414:Kcnh4 UTSW 11 100746896 missense probably damaging 1.00
R5682:Kcnh4 UTSW 11 100749802 missense possibly damaging 0.82
R5945:Kcnh4 UTSW 11 100745322 missense probably damaging 1.00
R6434:Kcnh4 UTSW 11 100750279 missense probably damaging 0.97
R6505:Kcnh4 UTSW 11 100757085 missense probably benign 0.39
R7263:Kcnh4 UTSW 11 100741817 missense probably benign 0.06
R7270:Kcnh4 UTSW 11 100747646 missense probably benign
R7353:Kcnh4 UTSW 11 100757199 missense probably benign 0.18
R7355:Kcnh4 UTSW 11 100752443 missense possibly damaging 0.92
R7544:Kcnh4 UTSW 11 100757080 missense probably benign 0.25
R7664:Kcnh4 UTSW 11 100750322 missense probably damaging 1.00
R7972:Kcnh4 UTSW 11 100752452 missense probably damaging 0.98
R8146:Kcnh4 UTSW 11 100755279 missense probably damaging 1.00
R8166:Kcnh4 UTSW 11 100741886 missense probably benign
R8234:Kcnh4 UTSW 11 100752267 missense possibly damaging 0.83
R8295:Kcnh4 UTSW 11 100749697 missense probably benign 0.17
R8318:Kcnh4 UTSW 11 100752328 missense probably damaging 1.00
R8347:Kcnh4 UTSW 11 100757749 missense probably damaging 1.00
R8413:Kcnh4 UTSW 11 100749793 missense possibly damaging 0.60
R8464:Kcnh4 UTSW 11 100757184 missense probably damaging 1.00
X0025:Kcnh4 UTSW 11 100750243 missense possibly damaging 0.91
X0061:Kcnh4 UTSW 11 100756907 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- GTGGAATGTGTCTGACCCAG -3'
(R):5'- GGCATCCATGAGACATTTTGCTATG -3'

Sequencing Primer
(F):5'- TCTGACCCAGACTGGAAGCTG -3'
(R):5'- GCTATGTTTTCAACAGATCTCCCG -3'
Posted On2019-10-17