Incidental Mutation 'R0619:Iqsec1'
ID58528
Institutional Source Beutler Lab
Gene Symbol Iqsec1
Ensembl Gene ENSMUSG00000034312
Gene NameIQ motif and Sec7 domain 1
SynonymsD6Ertd349e, cI-43, BRAG2
MMRRC Submission 038808-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.208) question?
Stock #R0619 (G1)
Quality Score209
Status Not validated
Chromosome6
Chromosomal Location90656088-90988685 bp(-) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) T to C at 90670406 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148669 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101151] [ENSMUST00000101153] [ENSMUST00000212100]
Predicted Effect probably null
Transcript: ENSMUST00000101151
SMART Domains Protein: ENSMUSP00000098710
Gene: ENSMUSG00000034312

DomainStartEndE-ValueType
low complexity region 57 68 N/A INTRINSIC
Blast:Sec7 69 369 6e-39 BLAST
low complexity region 370 389 N/A INTRINSIC
low complexity region 396 430 N/A INTRINSIC
low complexity region 450 481 N/A INTRINSIC
Sec7 505 696 1.31e-95 SMART
PH 737 848 2.39e-2 SMART
low complexity region 901 914 N/A INTRINSIC
low complexity region 963 976 N/A INTRINSIC
low complexity region 978 1000 N/A INTRINSIC
low complexity region 1014 1060 N/A INTRINSIC
low complexity region 1062 1094 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000101153
SMART Domains Protein: ENSMUSP00000098712
Gene: ENSMUSG00000034312

DomainStartEndE-ValueType
low complexity region 71 82 N/A INTRINSIC
Blast:Sec7 83 383 4e-39 BLAST
low complexity region 384 403 N/A INTRINSIC
low complexity region 410 444 N/A INTRINSIC
low complexity region 464 495 N/A INTRINSIC
Sec7 519 710 1.31e-95 SMART
PH 751 862 2.39e-2 SMART
low complexity region 915 928 N/A INTRINSIC
low complexity region 948 957 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141434
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154198
Predicted Effect probably null
Transcript: ENSMUST00000189881
SMART Domains Protein: ENSMUSP00000140030
Gene: ENSMUSG00000034312

DomainStartEndE-ValueType
low complexity region 71 82 N/A INTRINSIC
Blast:Sec7 83 383 5e-39 BLAST
low complexity region 384 403 N/A INTRINSIC
low complexity region 410 444 N/A INTRINSIC
low complexity region 464 495 N/A INTRINSIC
Sec7 519 710 6.5e-98 SMART
PH 751 862 1.1e-4 SMART
low complexity region 915 928 N/A INTRINSIC
low complexity region 977 990 N/A INTRINSIC
low complexity region 992 1014 N/A INTRINSIC
low complexity region 1028 1074 N/A INTRINSIC
low complexity region 1076 1108 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000212100
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a conditional allele activated in neurons fail to exhibit mGluR- and NMDAR-mediated long term depression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adad2 G A 8: 119,613,000 D74N probably benign Het
Adgre4 T A 17: 55,820,679 V573D possibly damaging Het
Ak7 A G 12: 105,733,511 K230E probably damaging Het
Amdhd2 T C 17: 24,156,588 D375G possibly damaging Het
Anpep T C 7: 79,841,009 E253G probably benign Het
Bbs7 A G 3: 36,607,576 L158S probably benign Het
BC037034 A G 5: 138,263,826 probably benign Het
Bdp1 T C 13: 100,037,858 T2057A probably benign Het
C2 G T 17: 34,872,503 H61Q probably damaging Het
Ccdc18 A G 5: 108,180,416 K661E probably benign Het
Cdh23 C T 10: 60,433,777 V655I probably damaging Het
Cep78 T C 19: 15,978,862 T238A probably damaging Het
Ces2a T A 8: 104,736,110 N110K probably benign Het
Crat T C 2: 30,409,984 D128G probably benign Het
Dclre1a A T 19: 56,545,409 M233K probably benign Het
Dsg4 T C 18: 20,461,359 V515A probably benign Het
Fer1l6 T C 15: 58,662,935 probably null Het
Fryl T C 5: 73,068,731 D1863G probably benign Het
Fsip2 T A 2: 82,944,140 L57Q probably damaging Het
Gnb4 C T 3: 32,591,207 V112I probably benign Het
Kcnn3 A C 3: 89,652,030 T536P probably damaging Het
Kctd3 T C 1: 188,978,643 D441G probably damaging Het
Kifc3 G A 8: 95,102,665 T528M probably benign Het
Kmt2c G A 5: 25,298,916 T3798I probably benign Het
Map1a T A 2: 121,305,255 M1946K probably damaging Het
Mfhas1 T A 8: 35,590,675 V768E probably benign Het
Mroh8 C A 2: 157,265,081 V223F possibly damaging Het
Mss51 A T 14: 20,487,573 V30E probably benign Het
Mtmr10 G A 7: 64,321,213 R392H probably benign Het
Mup3 T C 4: 62,085,961 N105S probably benign Het
Myh7b T C 2: 155,611,722 M22T probably benign Het
Olfr1034 T A 2: 86,047,311 Y276* probably null Het
Olfr170 T A 16: 19,606,272 Y132F probably damaging Het
Olfr97 T A 17: 37,232,155 I72F possibly damaging Het
Os9 A G 10: 127,120,991 I43T probably damaging Het
Pkhd1l1 T C 15: 44,483,838 L200P probably damaging Het
Ptpru C T 4: 131,820,887 V100M possibly damaging Het
Rnf6 G A 5: 146,210,721 R496C possibly damaging Het
Rsad1 C T 11: 94,542,639 R407Q probably damaging Het
Rspo3 T C 10: 29,504,637 D127G probably damaging Het
Sbf2 T A 7: 110,310,262 T1760S possibly damaging Het
Sh2d3c T A 2: 32,753,025 V588E probably damaging Het
Siglech A T 7: 55,769,162 T238S probably benign Het
Slc15a2 T A 16: 36,759,307 N328I probably damaging Het
Slc16a11 G T 11: 70,215,032 G94C probably damaging Het
Stub1 T C 17: 25,831,322 probably null Het
Tacc2 T A 7: 130,716,753 V40D probably damaging Het
Tagln3 C A 16: 45,724,272 R12L probably damaging Het
Tsen54 A G 11: 115,815,064 E69G probably damaging Het
Tsks A G 7: 44,950,834 E150G probably damaging Het
Ubap2l A C 3: 90,017,220 V680G probably benign Het
Usp16 A T 16: 87,472,164 H315L probably benign Het
Vav2 A G 2: 27,296,121 probably null Het
Zfc3h1 T C 10: 115,420,810 F1562L possibly damaging Het
Zfp764 C A 7: 127,406,541 V22L probably benign Het
Other mutations in Iqsec1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01324:Iqsec1 APN 6 90689703 missense probably damaging 1.00
IGL01749:Iqsec1 APN 6 90680504 missense probably benign 0.03
IGL01960:Iqsec1 APN 6 90676780 missense probably damaging 1.00
IGL02007:Iqsec1 APN 6 90690349 missense probably benign 0.37
IGL02045:Iqsec1 APN 6 90664069 missense probably damaging 0.96
IGL02186:Iqsec1 APN 6 90676877 missense probably damaging 1.00
IGL02211:Iqsec1 APN 6 90671609 missense probably damaging 1.00
IGL02503:Iqsec1 APN 6 90668788 missense probably damaging 1.00
IGL02506:Iqsec1 APN 6 90672075 missense possibly damaging 0.94
IGL02554:Iqsec1 APN 6 90669345 missense probably damaging 1.00
PIT4260001:Iqsec1 UTSW 6 90690489 missense probably damaging 1.00
PIT4810001:Iqsec1 UTSW 6 90670491 missense probably damaging 1.00
R0139:Iqsec1 UTSW 6 90809758 intron probably benign
R0371:Iqsec1 UTSW 6 90670403 splice site probably benign
R0617:Iqsec1 UTSW 6 90689970 missense probably damaging 1.00
R1157:Iqsec1 UTSW 6 90669384 missense possibly damaging 0.83
R1168:Iqsec1 UTSW 6 90689676 missense probably damaging 1.00
R1190:Iqsec1 UTSW 6 90689677 missense probably damaging 1.00
R1192:Iqsec1 UTSW 6 90671976 splice site probably benign
R1435:Iqsec1 UTSW 6 90672024 missense probably damaging 1.00
R1449:Iqsec1 UTSW 6 90690808 nonsense probably null
R1697:Iqsec1 UTSW 6 90809770 nonsense probably null
R1921:Iqsec1 UTSW 6 90662895 missense probably benign 0.00
R1958:Iqsec1 UTSW 6 90670459 missense probably damaging 1.00
R2017:Iqsec1 UTSW 6 90689930 missense probably benign 0.02
R2082:Iqsec1 UTSW 6 90694574 missense probably damaging 1.00
R2372:Iqsec1 UTSW 6 90694654 missense probably damaging 1.00
R2442:Iqsec1 UTSW 6 90689883 missense possibly damaging 0.52
R4120:Iqsec1 UTSW 6 90662602 nonsense probably null
R4371:Iqsec1 UTSW 6 90694606 missense probably damaging 1.00
R4645:Iqsec1 UTSW 6 90668013 missense probably damaging 1.00
R4864:Iqsec1 UTSW 6 90664056 missense probably damaging 1.00
R5436:Iqsec1 UTSW 6 90845361 intron probably benign
R5790:Iqsec1 UTSW 6 90689880 nonsense probably null
R6007:Iqsec1 UTSW 6 90660987 nonsense probably null
R6143:Iqsec1 UTSW 6 90809684 intron probably null
R6218:Iqsec1 UTSW 6 90689635 missense probably damaging 1.00
R6972:Iqsec1 UTSW 6 90676768 missense probably damaging 1.00
R7506:Iqsec1 UTSW 6 90662806 missense possibly damaging 0.53
R7506:Iqsec1 UTSW 6 90667909 missense probably damaging 1.00
R7539:Iqsec1 UTSW 6 90662891 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGGGCCAGATAGAGTCCTACAATG -3'
(R):5'- ATGCAACCTAAGTCCTGCCCAGAG -3'

Sequencing Primer
(F):5'- GTCCTACAATGTAGAGCACTCTGG -3'
(R):5'- GACAGAATCTCAGTGCCCCTG -3'
Posted On2013-07-11