Incidental Mutation 'R7563:Trim39'
ID585283
Institutional Source Beutler Lab
Gene Symbol Trim39
Ensembl Gene ENSMUSG00000045409
Gene Nametripartite motif-containing 39
SynonymsRnf23, RING-B box-coiled-coil-B30.2, RBCC-B30.2, tfp, 1100001D15Rik, E130103K13Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7563 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location36258873-36272247 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 36260915 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 317 (V317E)
Ref Sequence ENSEMBL: ENSMUSP00000133298 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025319] [ENSMUST00000042717] [ENSMUST00000077535] [ENSMUST00000113706] [ENSMUST00000172573] [ENSMUST00000173369] [ENSMUST00000173665]
Predicted Effect probably benign
Transcript: ENSMUST00000025319
SMART Domains Protein: ENSMUSP00000025319
Gene: ENSMUSG00000024446

DomainStartEndE-ValueType
Pfam:Rpr2 13 96 1.2e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000042717
AA Change: V309E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039790
Gene: ENSMUSG00000045409
AA Change: V309E

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
RING 29 69 1.9e-10 SMART
BBOX 102 143 3.21e-8 SMART
coiled coil region 184 240 N/A INTRINSIC
PRY 306 359 2.3e-27 SMART
SPRY 360 485 1.95e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000077535
SMART Domains Protein: ENSMUSP00000076739
Gene: ENSMUSG00000024446

DomainStartEndE-ValueType
low complexity region 28 42 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113706
AA Change: V309E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109336
Gene: ENSMUSG00000045409
AA Change: V309E

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
RING 29 69 1.9e-10 SMART
BBOX 102 143 3.21e-8 SMART
coiled coil region 184 240 N/A INTRINSIC
PRY 306 359 2.3e-27 SMART
SPRY 360 485 1.95e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172573
SMART Domains Protein: ENSMUSP00000133400
Gene: ENSMUSG00000024446

DomainStartEndE-ValueType
Pfam:Rpr2 1 48 4.4e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000173369
AA Change: V317E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133298
Gene: ENSMUSG00000045409
AA Change: V317E

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
RING 29 69 1.9e-10 SMART
BBOX 102 143 3.21e-8 SMART
coiled coil region 184 240 N/A INTRINSIC
PRY 314 367 1.23e-27 SMART
SPRY 368 493 1.95e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173665
SMART Domains Protein: ENSMUSP00000133529
Gene: ENSMUSG00000045409

DomainStartEndE-ValueType
BBOX 1 40 5.81e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The function of this protein has not been identified. This gene lies within the major histocompatibility complex class I region on chromosome 6. Alternate splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik A T 17: 23,717,328 F8L probably benign Het
Aadacl3 A G 4: 144,457,894 I98T probably damaging Het
Ahnak T C 19: 9,011,165 I3271T probably damaging Het
Aox1 G A 1: 58,047,145 V70I probably benign Het
Ap1g2 A G 14: 55,099,749 S710P probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Cacna1e T C 1: 154,471,416 K1064E probably benign Het
Capn11 T A 17: 45,633,965 I459F probably damaging Het
Ccnc A G 4: 21,732,220 I48V probably damaging Het
Ces1d T A 8: 93,178,039 I358F probably benign Het
Clgn A T 8: 83,420,556 N379I probably damaging Het
Cym T C 3: 107,214,232 Y248C probably damaging Het
Epha8 T C 4: 136,938,789 D352G possibly damaging Het
Eya2 T C 2: 165,716,130 probably null Het
Fbxl5 C T 5: 43,821,549 V20I probably benign Het
Fscb T C 12: 64,473,285 E469G possibly damaging Het
Glt8d2 A T 10: 82,660,825 probably null Het
Gm13088 A T 4: 143,654,105 Y449* probably null Het
Helt T C 8: 46,293,593 probably benign Het
Igkv8-27 G T 6: 70,171,903 T89K probably benign Het
Ipo5 T A 14: 120,946,155 H1048Q probably benign Het
Kalrn T C 16: 34,392,094 D28G probably damaging Het
Kcnh4 G A 11: 100,741,854 P936S probably benign Het
Klrd1 A G 6: 129,593,738 I37M possibly damaging Het
Kmt2e T C 5: 23,500,273 V1267A probably damaging Het
Lrrc29 A G 8: 105,315,756 C147R probably benign Het
March1 A T 8: 66,468,313 Q214L probably damaging Het
Mlip G T 9: 77,112,997 H52N probably damaging Het
Oas1e T C 5: 120,788,956 R229G probably benign Het
Ogfr T A 2: 180,592,507 probably null Het
Olfr1023 T A 2: 85,887,138 Y113N probably damaging Het
Olfr1279 T C 2: 111,306,789 F195L probably benign Het
Pde4d T C 13: 109,951,007 I636T probably benign Het
Pex5l C T 3: 32,954,476 V426I probably damaging Het
Pmfbp1 A G 8: 109,525,374 K384E possibly damaging Het
Prl6a1 T G 13: 27,314,238 probably null Het
Prss23 A T 7: 89,509,830 W344R probably damaging Het
Ptar1 T A 19: 23,720,316 D397E probably benign Het
Qrsl1 G A 10: 43,876,517 R437C probably damaging Het
Rab6a G T 7: 100,608,197 probably benign Het
Samd14 C A 11: 95,021,413 S205R probably benign Het
Sel1l3 T C 5: 53,185,984 Y322C probably damaging Het
Slc30a5 A T 13: 100,803,972 L669I probably benign Het
Ssc4d A G 5: 135,963,033 L419P probably damaging Het
Tbc1d2b A T 9: 90,219,010 Y642* probably null Het
Tbc1d2b A C 9: 90,226,248 F417V probably benign Het
Top2a T C 11: 99,016,179 D212G probably damaging Het
Uncx G A 5: 139,544,506 R113H probably damaging Het
Usp4 A G 9: 108,379,344 S655G probably benign Het
Vmn2r114 C T 17: 23,291,026 V827I probably benign Het
Vmn2r28 T A 7: 5,488,201 N349I probably benign Het
Vmn2r3 A G 3: 64,275,349 W310R possibly damaging Het
Xirp2 T C 2: 67,509,901 W829R probably damaging Het
Zfp574 C A 7: 25,081,352 H600N possibly damaging Het
Other mutations in Trim39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01458:Trim39 APN 17 36263963 splice site probably benign
IGL01462:Trim39 APN 17 36263725 splice site probably benign
IGL02243:Trim39 APN 17 36260384 missense probably damaging 1.00
IGL03390:Trim39 APN 17 36260571 missense probably damaging 0.99
PIT4305001:Trim39 UTSW 17 36268970 missense possibly damaging 0.93
R0458:Trim39 UTSW 17 36261512 missense probably damaging 1.00
R0569:Trim39 UTSW 17 36263731 missense probably benign 0.36
R1565:Trim39 UTSW 17 36268854 missense probably damaging 1.00
R1769:Trim39 UTSW 17 36263940 missense probably damaging 1.00
R1969:Trim39 UTSW 17 36268753 missense probably benign 0.01
R2009:Trim39 UTSW 17 36263754 missense possibly damaging 0.92
R2568:Trim39 UTSW 17 36269164 unclassified probably benign
R5206:Trim39 UTSW 17 36260490 missense probably damaging 1.00
R5443:Trim39 UTSW 17 36260753 missense probably damaging 1.00
R6481:Trim39 UTSW 17 36268662 missense probably benign 0.03
R7132:Trim39 UTSW 17 36260655 missense probably benign 0.25
R7739:Trim39 UTSW 17 36260504 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- CATACTCCTACTGCCCAGTG -3'
(R):5'- GATATGGATCCTTCTCTCTGGC -3'

Sequencing Primer
(F):5'- CTACTGCCCAGTGGGTCTTG -3'
(R):5'- TCTGGCCCTCACTCAGACAG -3'
Posted On2019-10-17