Incidental Mutation 'R7564:Pramel29'
ID 585303
Institutional Source Beutler Lab
Gene Symbol Pramel29
Ensembl Gene ENSMUSG00000046262
Gene Name PRAME like 29
Synonyms C87977
MMRRC Submission 045656-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.126) question?
Stock # R7564 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 143933332-143939587 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 143939525 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Phenylalanine at position 4 (C4F)
Ref Sequence ENSEMBL: ENSMUSP00000101383 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105753] [ENSMUST00000105754] [ENSMUST00000105755] [ENSMUST00000105757] [ENSMUST00000146836] [ENSMUST00000147855]
AlphaFold A2A958
Predicted Effect probably damaging
Transcript: ENSMUST00000105753
AA Change: C4F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000105754
AA Change: C4F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000105755
SMART Domains Protein: ENSMUSP00000101381
Gene: ENSMUSG00000046262

DomainStartEndE-ValueType
SCOP:d1a4ya_ 52 250 9e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105757
AA Change: C4F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101383
Gene: ENSMUSG00000046262
AA Change: C4F

DomainStartEndE-ValueType
SCOP:d1a4ya_ 222 420 1e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146836
Predicted Effect probably benign
Transcript: ENSMUST00000147855
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency 98% (56/57)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad11 G A 9: 104,000,288 (GRCm39) E681K possibly damaging Het
Accsl A T 2: 93,688,501 (GRCm39) M411K possibly damaging Het
Amn1 C T 6: 149,086,529 (GRCm39) M44I probably benign Het
Bag4 G A 8: 26,267,507 (GRCm39) R108* probably null Het
Cpa1 C T 6: 30,641,767 (GRCm39) T197M probably damaging Het
Cyb561d2 A G 9: 107,418,218 (GRCm39) V50A probably benign Het
Dact1 A G 12: 71,365,325 (GRCm39) D665G probably damaging Het
Dcaf4 G A 12: 83,588,297 (GRCm39) V499I probably damaging Het
Depdc5 T G 5: 33,058,854 (GRCm39) I274M probably damaging Het
Dnah3 T A 7: 119,570,817 (GRCm39) Q2219L probably benign Het
Ect2 A T 3: 27,170,272 (GRCm39) probably benign Het
Efcab14 C A 4: 115,617,159 (GRCm39) S289R probably benign Het
Fmn2 T C 1: 174,437,140 (GRCm39) L1037P unknown Het
Fsip2 G A 2: 82,819,361 (GRCm39) M5031I probably benign Het
Gm19410 A G 8: 36,274,151 (GRCm39) M1435V probably benign Het
Gm8005 G T 14: 42,261,499 (GRCm39) Q44K Het
Hdgfl2 T A 17: 56,406,860 (GRCm39) D591E unknown Het
Hk3 C A 13: 55,159,209 (GRCm39) C449F probably damaging Het
Hmcn1 T C 1: 150,531,586 (GRCm39) M3228V probably benign Het
Kifap3 C T 1: 163,743,337 (GRCm39) R773C probably damaging Het
Kndc1 T C 7: 139,500,612 (GRCm39) V659A probably benign Het
Lhb C T 7: 45,071,101 (GRCm39) R109C probably damaging Het
Lnpep A G 17: 17,798,854 (GRCm39) I267T probably benign Het
Lypla1 T A 1: 4,878,590 (GRCm39) probably null Het
Map3k21 T C 8: 126,654,447 (GRCm39) probably null Het
Mapkbp1 A G 2: 119,844,232 (GRCm39) T319A probably benign Het
Mms19 T C 19: 41,935,455 (GRCm39) T854A probably benign Het
Mphosph8 A G 14: 56,911,495 (GRCm39) T173A probably benign Het
Mtcl1 C T 17: 66,678,322 (GRCm39) R668H probably benign Het
Myo5b G A 18: 74,767,582 (GRCm39) E297K possibly damaging Het
Nrg2 A T 18: 36,157,449 (GRCm39) L412Q probably damaging Het
Nrtn T C 17: 57,058,473 (GRCm39) D176G probably damaging Het
Nrxn1 G T 17: 90,670,334 (GRCm39) Q1134K possibly damaging Het
Oog4 CAA CA 4: 143,164,022 (GRCm39) probably null Het
Or51t4 C T 7: 102,598,473 (GRCm39) P267L probably damaging Het
Pick1 T C 15: 79,139,781 (GRCm39) V360A unknown Het
Pigr T A 1: 130,769,403 (GRCm39) N71K possibly damaging Het
Ppox T C 1: 171,107,765 (GRCm39) N96S probably benign Het
Qrfprl G T 6: 65,429,891 (GRCm39) E196* probably null Het
Rasa1 T C 13: 85,376,827 (GRCm39) T603A probably benign Het
Rhd T C 4: 134,603,770 (GRCm39) L97P probably damaging Het
Sec61a2 T C 2: 5,887,415 (GRCm39) I147V probably benign Het
Sh3bp1 C T 15: 78,795,760 (GRCm39) P630S probably damaging Het
Sh3d21 T C 4: 126,044,937 (GRCm39) T581A probably benign Het
Slc36a2 A G 11: 55,053,498 (GRCm39) I380T probably benign Het
Slc36a4 T A 9: 15,638,108 (GRCm39) V178D probably damaging Het
Smad7 C A 18: 75,526,906 (GRCm39) L251I probably benign Het
Sspo G A 6: 48,426,434 (GRCm39) S151N probably benign Het
St3gal4 C T 9: 34,963,549 (GRCm39) R253Q probably benign Het
Trappc14 C A 5: 138,261,104 (GRCm39) probably null Het
Ttbk1 T C 17: 46,787,857 (GRCm39) I242V possibly damaging Het
Ttn G A 2: 76,798,864 (GRCm39) A470V unknown Het
Unc13b T C 4: 43,091,258 (GRCm39) V28A probably damaging Het
Vmn1r149 A G 7: 22,137,530 (GRCm39) V42A possibly damaging Het
Zbtb21 A T 16: 97,752,740 (GRCm39) C514* probably null Het
Zfp236 A T 18: 82,662,366 (GRCm39) C570* probably null Het
Zfp277 T A 12: 40,379,594 (GRCm39) R313S probably damaging Het
Zfp329 A T 7: 12,544,967 (GRCm39) C186S probably damaging Het
Zscan4-ps2 A G 7: 11,248,954 (GRCm39) probably benign Het
Other mutations in Pramel29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Pramel29 APN 4 143,935,045 (GRCm39) missense possibly damaging 0.58
IGL02950:Pramel29 APN 4 143,939,531 (GRCm39) missense probably benign 0.06
IGL03174:Pramel29 APN 4 143,935,000 (GRCm39) missense probably benign
IGL03178:Pramel29 APN 4 143,934,821 (GRCm39) critical splice donor site probably null
PIT4812001:Pramel29 UTSW 4 143,936,086 (GRCm39) missense probably benign
R0622:Pramel29 UTSW 4 143,939,583 (GRCm39) unclassified probably benign
R0634:Pramel29 UTSW 4 143,935,910 (GRCm39) critical splice donor site probably null
R1127:Pramel29 UTSW 4 143,933,694 (GRCm39) missense probably damaging 1.00
R1341:Pramel29 UTSW 4 143,934,129 (GRCm39) missense probably damaging 1.00
R1697:Pramel29 UTSW 4 143,935,162 (GRCm39) missense probably damaging 1.00
R1827:Pramel29 UTSW 4 143,936,180 (GRCm39) missense probably damaging 0.99
R1857:Pramel29 UTSW 4 143,935,091 (GRCm39) missense possibly damaging 0.74
R2859:Pramel29 UTSW 4 143,936,192 (GRCm39) missense probably benign 0.11
R4063:Pramel29 UTSW 4 143,935,265 (GRCm39) missense possibly damaging 0.87
R4114:Pramel29 UTSW 4 143,936,173 (GRCm39) missense probably damaging 1.00
R4130:Pramel29 UTSW 4 143,935,379 (GRCm39) missense probably damaging 0.99
R4255:Pramel29 UTSW 4 143,934,054 (GRCm39) missense possibly damaging 0.68
R4704:Pramel29 UTSW 4 143,935,162 (GRCm39) missense probably damaging 1.00
R4840:Pramel29 UTSW 4 143,935,144 (GRCm39) missense probably damaging 0.98
R5267:Pramel29 UTSW 4 143,939,575 (GRCm39) unclassified probably benign
R5670:Pramel29 UTSW 4 143,936,192 (GRCm39) missense probably benign 0.11
R6149:Pramel29 UTSW 4 143,933,983 (GRCm39) missense probably damaging 0.98
R6508:Pramel29 UTSW 4 143,934,171 (GRCm39) nonsense probably null
R6528:Pramel29 UTSW 4 143,935,381 (GRCm39) missense probably damaging 0.99
R7252:Pramel29 UTSW 4 143,939,510 (GRCm39) missense possibly damaging 0.95
R7704:Pramel29 UTSW 4 143,935,091 (GRCm39) missense possibly damaging 0.74
R8737:Pramel29 UTSW 4 143,935,192 (GRCm39) missense probably damaging 1.00
R9703:Pramel29 UTSW 4 143,939,510 (GRCm39) missense probably damaging 0.97
Z1176:Pramel29 UTSW 4 143,934,031 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TCTAGGATTGAGGTCAAGCAATC -3'
(R):5'- AGATCTGGTCCAATTTACCTACAC -3'

Sequencing Primer
(F):5'- AATCTTGCCTAGAAATAACTGATCTC -3'
(R):5'- TGGAGACACAATGATGGAGACTC -3'
Posted On 2019-10-17