Incidental Mutation 'R7564:Amn1'
ID 585308
Institutional Source Beutler Lab
Gene Symbol Amn1
Ensembl Gene ENSMUSG00000068250
Gene Name antagonist of mitotic exit network 1
Synonyms C730024G19Rik
MMRRC Submission 045656-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.086) question?
Stock # R7564 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 149059075-149090210 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 149086529 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Isoleucine at position 44 (M44I)
Ref Sequence ENSEMBL: ENSMUSP00000107160 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095319] [ENSMUST00000111535] [ENSMUST00000141346]
AlphaFold B8JKV0
Predicted Effect probably null
Transcript: ENSMUST00000095319
AA Change: M1I

PolyPhen 2 Score 0.866 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000092957
Gene: ENSMUSG00000068250
AA Change: M1I

DomainStartEndE-ValueType
LRR 17 41 2.82e0 SMART
LRR 42 70 1.52e2 SMART
LRR 71 96 1.25e-1 SMART
LRR 97 122 3.89e-3 SMART
LRR 123 147 1.44e1 SMART
LRR 150 175 1.28e1 SMART
Blast:LRR 176 204 3e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000111535
AA Change: M44I

PolyPhen 2 Score 0.191 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000107160
Gene: ENSMUSG00000068250
AA Change: M44I

DomainStartEndE-ValueType
LRR 60 84 2.82e0 SMART
LRR 85 113 1.52e2 SMART
LRR 114 139 1.25e-1 SMART
LRR 140 165 3.89e-3 SMART
LRR 166 190 1.44e1 SMART
LRR 193 218 1.28e1 SMART
Blast:LRR 219 247 4e-10 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000141346
AA Change: M1I

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000116060
Gene: ENSMUSG00000068250
AA Change: M1I

DomainStartEndE-ValueType
LRR 17 41 2.82e0 SMART
LRR 42 70 1.52e2 SMART
LRR 71 96 1.25e-1 SMART
LRR 97 121 1.44e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156864
Meta Mutation Damage Score 0.0647 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency 98% (56/57)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad11 G A 9: 104,000,288 (GRCm39) E681K possibly damaging Het
Accsl A T 2: 93,688,501 (GRCm39) M411K possibly damaging Het
Bag4 G A 8: 26,267,507 (GRCm39) R108* probably null Het
Cpa1 C T 6: 30,641,767 (GRCm39) T197M probably damaging Het
Cyb561d2 A G 9: 107,418,218 (GRCm39) V50A probably benign Het
Dact1 A G 12: 71,365,325 (GRCm39) D665G probably damaging Het
Dcaf4 G A 12: 83,588,297 (GRCm39) V499I probably damaging Het
Depdc5 T G 5: 33,058,854 (GRCm39) I274M probably damaging Het
Dnah3 T A 7: 119,570,817 (GRCm39) Q2219L probably benign Het
Ect2 A T 3: 27,170,272 (GRCm39) probably benign Het
Efcab14 C A 4: 115,617,159 (GRCm39) S289R probably benign Het
Fmn2 T C 1: 174,437,140 (GRCm39) L1037P unknown Het
Fsip2 G A 2: 82,819,361 (GRCm39) M5031I probably benign Het
Gm19410 A G 8: 36,274,151 (GRCm39) M1435V probably benign Het
Gm8005 G T 14: 42,261,499 (GRCm39) Q44K Het
Hdgfl2 T A 17: 56,406,860 (GRCm39) D591E unknown Het
Hk3 C A 13: 55,159,209 (GRCm39) C449F probably damaging Het
Hmcn1 T C 1: 150,531,586 (GRCm39) M3228V probably benign Het
Kifap3 C T 1: 163,743,337 (GRCm39) R773C probably damaging Het
Kndc1 T C 7: 139,500,612 (GRCm39) V659A probably benign Het
Lhb C T 7: 45,071,101 (GRCm39) R109C probably damaging Het
Lnpep A G 17: 17,798,854 (GRCm39) I267T probably benign Het
Lypla1 T A 1: 4,878,590 (GRCm39) probably null Het
Map3k21 T C 8: 126,654,447 (GRCm39) probably null Het
Mapkbp1 A G 2: 119,844,232 (GRCm39) T319A probably benign Het
Mms19 T C 19: 41,935,455 (GRCm39) T854A probably benign Het
Mphosph8 A G 14: 56,911,495 (GRCm39) T173A probably benign Het
Mtcl1 C T 17: 66,678,322 (GRCm39) R668H probably benign Het
Myo5b G A 18: 74,767,582 (GRCm39) E297K possibly damaging Het
Nrg2 A T 18: 36,157,449 (GRCm39) L412Q probably damaging Het
Nrtn T C 17: 57,058,473 (GRCm39) D176G probably damaging Het
Nrxn1 G T 17: 90,670,334 (GRCm39) Q1134K possibly damaging Het
Oog4 CAA CA 4: 143,164,022 (GRCm39) probably null Het
Or51t4 C T 7: 102,598,473 (GRCm39) P267L probably damaging Het
Pick1 T C 15: 79,139,781 (GRCm39) V360A unknown Het
Pigr T A 1: 130,769,403 (GRCm39) N71K possibly damaging Het
Ppox T C 1: 171,107,765 (GRCm39) N96S probably benign Het
Pramel29 C A 4: 143,939,525 (GRCm39) C4F probably damaging Het
Qrfprl G T 6: 65,429,891 (GRCm39) E196* probably null Het
Rasa1 T C 13: 85,376,827 (GRCm39) T603A probably benign Het
Rhd T C 4: 134,603,770 (GRCm39) L97P probably damaging Het
Sec61a2 T C 2: 5,887,415 (GRCm39) I147V probably benign Het
Sh3bp1 C T 15: 78,795,760 (GRCm39) P630S probably damaging Het
Sh3d21 T C 4: 126,044,937 (GRCm39) T581A probably benign Het
Slc36a2 A G 11: 55,053,498 (GRCm39) I380T probably benign Het
Slc36a4 T A 9: 15,638,108 (GRCm39) V178D probably damaging Het
Smad7 C A 18: 75,526,906 (GRCm39) L251I probably benign Het
Sspo G A 6: 48,426,434 (GRCm39) S151N probably benign Het
St3gal4 C T 9: 34,963,549 (GRCm39) R253Q probably benign Het
Trappc14 C A 5: 138,261,104 (GRCm39) probably null Het
Ttbk1 T C 17: 46,787,857 (GRCm39) I242V possibly damaging Het
Ttn G A 2: 76,798,864 (GRCm39) A470V unknown Het
Unc13b T C 4: 43,091,258 (GRCm39) V28A probably damaging Het
Vmn1r149 A G 7: 22,137,530 (GRCm39) V42A possibly damaging Het
Zbtb21 A T 16: 97,752,740 (GRCm39) C514* probably null Het
Zfp236 A T 18: 82,662,366 (GRCm39) C570* probably null Het
Zfp277 T A 12: 40,379,594 (GRCm39) R313S probably damaging Het
Zfp329 A T 7: 12,544,967 (GRCm39) C186S probably damaging Het
Zscan4-ps2 A G 7: 11,248,954 (GRCm39) probably benign Het
Other mutations in Amn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02391:Amn1 APN 6 149,070,944 (GRCm39) critical splice donor site probably null
PIT4453001:Amn1 UTSW 6 149,072,357 (GRCm39) missense probably benign 0.00
R0153:Amn1 UTSW 6 149,090,091 (GRCm39) utr 5 prime probably benign
R0494:Amn1 UTSW 6 149,086,634 (GRCm39) unclassified probably benign
R0557:Amn1 UTSW 6 149,072,503 (GRCm39) missense possibly damaging 0.50
R0717:Amn1 UTSW 6 149,084,970 (GRCm39) missense possibly damaging 0.88
R0736:Amn1 UTSW 6 149,084,970 (GRCm39) missense possibly damaging 0.88
R3420:Amn1 UTSW 6 149,070,950 (GRCm39) nonsense probably null
R3421:Amn1 UTSW 6 149,070,950 (GRCm39) nonsense probably null
R4466:Amn1 UTSW 6 149,068,343 (GRCm39) splice site probably null
R4760:Amn1 UTSW 6 149,086,611 (GRCm39) missense probably benign
R5294:Amn1 UTSW 6 149,086,622 (GRCm39) unclassified probably benign
R5356:Amn1 UTSW 6 149,068,392 (GRCm39) missense possibly damaging 0.80
R5561:Amn1 UTSW 6 149,086,522 (GRCm39) missense probably damaging 0.98
R7501:Amn1 UTSW 6 149,086,529 (GRCm39) missense probably benign 0.19
R7643:Amn1 UTSW 6 149,086,529 (GRCm39) missense probably benign 0.19
R7645:Amn1 UTSW 6 149,086,529 (GRCm39) missense probably benign 0.19
R8097:Amn1 UTSW 6 149,070,853 (GRCm39) unclassified probably benign
R9390:Amn1 UTSW 6 149,084,983 (GRCm39) missense probably damaging 1.00
R9565:Amn1 UTSW 6 149,090,103 (GRCm39) start gained probably benign
X0064:Amn1 UTSW 6 149,072,533 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACTGGCTTTTCAAGTCAAAG -3'
(R):5'- GAGGCAGTGATTATGAATGTCATC -3'

Sequencing Primer
(F):5'- CTAAAACTAAGTCTAAACAGTGA -3'
(R):5'- GTCTTATGAAAGGACTAAGTGCTGAC -3'
Posted On 2019-10-17