Incidental Mutation 'R7564:Zfp329'
ID585310
Institutional Source Beutler Lab
Gene Symbol Zfp329
Ensembl Gene ENSMUSG00000057894
Gene Namezinc finger protein 329
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7564 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location12804977-12818858 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 12811040 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 186 (C186S)
Ref Sequence ENSEMBL: ENSMUSP00000072079 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072222] [ENSMUST00000108546] [ENSMUST00000121215]
Predicted Effect probably damaging
Transcript: ENSMUST00000072222
AA Change: C186S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000072079
Gene: ENSMUSG00000057894
AA Change: C186S

DomainStartEndE-ValueType
low complexity region 147 160 N/A INTRINSIC
ZnF_C2H2 184 206 9.58e-3 SMART
ZnF_C2H2 212 234 1.12e-3 SMART
ZnF_C2H2 240 262 1.22e-4 SMART
ZnF_C2H2 268 290 1.95e-3 SMART
ZnF_C2H2 296 318 2.61e-4 SMART
ZnF_C2H2 324 346 5.14e-3 SMART
ZnF_C2H2 352 374 2.24e-3 SMART
ZnF_C2H2 380 402 5.21e-4 SMART
ZnF_C2H2 408 430 1.92e-2 SMART
ZnF_C2H2 436 458 5.21e-4 SMART
ZnF_C2H2 464 486 3.16e-3 SMART
ZnF_C2H2 492 514 2.2e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108546
AA Change: C186S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104186
Gene: ENSMUSG00000057894
AA Change: C186S

DomainStartEndE-ValueType
low complexity region 147 160 N/A INTRINSIC
ZnF_C2H2 184 206 9.58e-3 SMART
ZnF_C2H2 212 234 1.12e-3 SMART
ZnF_C2H2 240 262 1.22e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121215
AA Change: C186S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113355
Gene: ENSMUSG00000057894
AA Change: C186S

DomainStartEndE-ValueType
low complexity region 147 160 N/A INTRINSIC
ZnF_C2H2 184 206 9.58e-3 SMART
ZnF_C2H2 212 234 1.12e-3 SMART
ZnF_C2H2 240 262 1.22e-4 SMART
ZnF_C2H2 268 290 1.95e-3 SMART
ZnF_C2H2 296 318 2.61e-4 SMART
ZnF_C2H2 324 346 5.14e-3 SMART
ZnF_C2H2 352 374 2.24e-3 SMART
ZnF_C2H2 380 402 5.21e-4 SMART
ZnF_C2H2 408 430 1.92e-2 SMART
ZnF_C2H2 436 458 5.21e-4 SMART
ZnF_C2H2 464 486 3.16e-3 SMART
ZnF_C2H2 492 514 2.2e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad11 G A 9: 104,123,089 E681K possibly damaging Het
Accsl A T 2: 93,858,156 M411K possibly damaging Het
Amn1 C T 6: 149,185,031 M44I probably benign Het
Bag4 G A 8: 25,777,479 R108* probably null Het
BC037034 C A 5: 138,262,842 probably null Het
C130060K24Rik G T 6: 65,452,907 E196* probably null Het
C87977 C A 4: 144,212,955 C4F probably damaging Het
Cpa1 C T 6: 30,641,768 T197M probably damaging Het
Cyb561d2 A G 9: 107,541,019 V50A probably benign Het
Dact1 A G 12: 71,318,551 D665G probably damaging Het
Dcaf4 G A 12: 83,541,523 V499I probably damaging Het
Depdc5 T G 5: 32,901,510 I274M probably damaging Het
Dnah3 T A 7: 119,971,594 Q2219L probably benign Het
Efcab14 C A 4: 115,759,962 S289R probably benign Het
Fmn2 T C 1: 174,609,574 L1037P unknown Het
Fsip2 G A 2: 82,989,017 M5031I probably benign Het
Gm19410 A G 8: 35,806,997 M1435V probably benign Het
Gm8005 G T 14: 42,439,542 Q44K Het
Hdgfl2 T A 17: 56,099,860 D591E unknown Het
Hk3 C A 13: 55,011,396 C449F probably damaging Het
Hmcn1 T C 1: 150,655,835 M3228V probably benign Het
Kifap3 C T 1: 163,915,768 R773C probably damaging Het
Kndc1 T C 7: 139,920,696 V659A probably benign Het
Lhb C T 7: 45,421,677 R109C probably damaging Het
Lnpep A G 17: 17,578,592 I267T probably benign Het
Lypla1 T A 1: 4,808,367 probably null Het
Map3k21 T C 8: 125,927,708 probably null Het
Mapkbp1 A G 2: 120,013,751 T319A probably benign Het
Mms19 T C 19: 41,947,016 T854A probably benign Het
Mphosph8 A G 14: 56,674,038 T173A probably benign Het
Mtcl1 C T 17: 66,371,327 R668H probably benign Het
Myo5b G A 18: 74,634,511 E297K possibly damaging Het
Nrg2 A T 18: 36,024,396 L412Q probably damaging Het
Nrtn T C 17: 56,751,473 D176G probably damaging Het
Nrxn1 G T 17: 90,362,906 Q1134K possibly damaging Het
Olfr574 C T 7: 102,949,266 P267L probably damaging Het
Oog4 CAA CA 4: 143,437,452 probably null Het
Pick1 T C 15: 79,255,581 V360A unknown Het
Pigr T A 1: 130,841,666 N71K possibly damaging Het
Ppox T C 1: 171,280,191 N96S probably benign Het
Rasa1 T C 13: 85,228,708 T603A probably benign Het
Rhd T C 4: 134,876,459 L97P probably damaging Het
Sec61a2 T C 2: 5,882,604 I147V probably benign Het
Sh3bp1 C T 15: 78,911,560 P630S probably damaging Het
Sh3d21 T C 4: 126,151,144 T581A probably benign Het
Slc36a2 A G 11: 55,162,672 I380T probably benign Het
Slc36a4 T A 9: 15,726,812 V178D probably damaging Het
Smad7 C A 18: 75,393,835 L251I probably benign Het
Sspo G A 6: 48,449,500 S151N probably benign Het
St3gal4 C T 9: 35,052,253 R253Q probably benign Het
Ttbk1 T C 17: 46,476,931 I242V possibly damaging Het
Ttn G A 2: 76,968,520 A470V unknown Het
Unc13b T C 4: 43,091,258 V28A probably damaging Het
Vmn1r149 A G 7: 22,438,105 V42A possibly damaging Het
Zbtb21 A T 16: 97,951,540 C514* probably null Het
Zfp236 A T 18: 82,644,241 C570* probably null Het
Zfp277 T A 12: 40,329,595 R313S probably damaging Het
Zscan4-ps2 A G 7: 11,515,027 probably benign Het
Other mutations in Zfp329
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02501:Zfp329 APN 7 12811179 missense possibly damaging 0.87
IGL02830:Zfp329 APN 7 12810116 missense probably damaging 1.00
R0069:Zfp329 UTSW 7 12810932 missense probably damaging 0.98
R0069:Zfp329 UTSW 7 12810932 missense probably damaging 0.98
R0122:Zfp329 UTSW 7 12810987 missense probably damaging 1.00
R0238:Zfp329 UTSW 7 12810829 missense probably damaging 1.00
R0238:Zfp329 UTSW 7 12810829 missense probably damaging 1.00
R0539:Zfp329 UTSW 7 12806593 critical splice acceptor site probably null
R0570:Zfp329 UTSW 7 12810452 missense probably damaging 1.00
R0682:Zfp329 UTSW 7 12810284 missense probably damaging 1.00
R0811:Zfp329 UTSW 7 12811468 missense probably benign
R0812:Zfp329 UTSW 7 12811468 missense probably benign
R0944:Zfp329 UTSW 7 12811468 missense probably benign
R0945:Zfp329 UTSW 7 12811468 missense probably benign
R0946:Zfp329 UTSW 7 12811468 missense probably benign
R0948:Zfp329 UTSW 7 12811468 missense probably benign
R1632:Zfp329 UTSW 7 12810949 missense possibly damaging 0.63
R1980:Zfp329 UTSW 7 12811468 missense probably benign
R2172:Zfp329 UTSW 7 12810767 missense probably damaging 1.00
R2897:Zfp329 UTSW 7 12810486 missense probably damaging 1.00
R4256:Zfp329 UTSW 7 12807913 missense probably benign 0.03
R4383:Zfp329 UTSW 7 12811657 start gained probably benign
R4384:Zfp329 UTSW 7 12811657 start gained probably benign
R4692:Zfp329 UTSW 7 12810632 missense probably damaging 1.00
R5260:Zfp329 UTSW 7 12806526 unclassified probably benign
R5327:Zfp329 UTSW 7 12811494 missense probably benign 0.04
R5679:Zfp329 UTSW 7 12810031 missense probably damaging 0.96
R6886:Zfp329 UTSW 7 12810098 missense probably benign 0.00
R6904:Zfp329 UTSW 7 12806530 unclassified probably benign
R7304:Zfp329 UTSW 7 12810899 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCATCTCGGAAAGCCTTTC -3'
(R):5'- CCATGGAAGCCACTCAACTTG -3'

Sequencing Primer
(F):5'- AATGTCAGTGAAGGGCTTCCC -3'
(R):5'- TGGAAGCCACTCAACTTGTAAGAAAC -3'
Posted On2019-10-17