Incidental Mutation 'R7564:Dact1'
ID585325
Institutional Source Beutler Lab
Gene Symbol Dact1
Ensembl Gene ENSMUSG00000044548
Gene Namedishevelled-binding antagonist of beta-catenin 1
SynonymsFrodo, Dapper1, Frodo1, THYEX3, Frd1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7564 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location71309884-71320107 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 71318551 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 665 (D665G)
Ref Sequence ENSEMBL: ENSMUSP00000058943 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061273] [ENSMUST00000150639]
Predicted Effect probably damaging
Transcript: ENSMUST00000061273
AA Change: D665G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058943
Gene: ENSMUSG00000044548
AA Change: D665G

DomainStartEndE-ValueType
Pfam:Dapper 39 206 4.1e-83 PFAM
Pfam:Dapper 204 778 7.8e-184 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000150639
AA Change: D702G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117169
Gene: ENSMUSG00000044548
AA Change: D702G

DomainStartEndE-ValueType
Pfam:Dapper 39 815 1.4e-240 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the dapper family, characterized by the presence of PDZ-binding motif at the C-terminus. It interacts with, and positively regulates dishevelled-mediated signaling pathways during development. Depletion of this mRNA from xenopus embryos resulted in loss of notochord and head structures, and mice lacking this gene died shortly after birth from severe posterior malformations. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality, abnormal embryogenesis, blind-ended colons, and abnormal renal/urinary system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad11 G A 9: 104,123,089 E681K possibly damaging Het
Accsl A T 2: 93,858,156 M411K possibly damaging Het
Amn1 C T 6: 149,185,031 M44I probably benign Het
Bag4 G A 8: 25,777,479 R108* probably null Het
BC037034 C A 5: 138,262,842 probably null Het
C130060K24Rik G T 6: 65,452,907 E196* probably null Het
C87977 C A 4: 144,212,955 C4F probably damaging Het
Cpa1 C T 6: 30,641,768 T197M probably damaging Het
Cyb561d2 A G 9: 107,541,019 V50A probably benign Het
Dcaf4 G A 12: 83,541,523 V499I probably damaging Het
Depdc5 T G 5: 32,901,510 I274M probably damaging Het
Dnah3 T A 7: 119,971,594 Q2219L probably benign Het
Ect2 A T 3: 27,116,123 probably benign Het
Efcab14 C A 4: 115,759,962 S289R probably benign Het
Fmn2 T C 1: 174,609,574 L1037P unknown Het
Fsip2 G A 2: 82,989,017 M5031I probably benign Het
Gm19410 A G 8: 35,806,997 M1435V probably benign Het
Gm8005 G T 14: 42,439,542 Q44K Het
Hdgfl2 T A 17: 56,099,860 D591E unknown Het
Hk3 C A 13: 55,011,396 C449F probably damaging Het
Hmcn1 T C 1: 150,655,835 M3228V probably benign Het
Kifap3 C T 1: 163,915,768 R773C probably damaging Het
Kndc1 T C 7: 139,920,696 V659A probably benign Het
Lhb C T 7: 45,421,677 R109C probably damaging Het
Lnpep A G 17: 17,578,592 I267T probably benign Het
Lypla1 T A 1: 4,808,367 probably null Het
Map3k21 T C 8: 125,927,708 probably null Het
Mapkbp1 A G 2: 120,013,751 T319A probably benign Het
Mms19 T C 19: 41,947,016 T854A probably benign Het
Mphosph8 A G 14: 56,674,038 T173A probably benign Het
Mtcl1 C T 17: 66,371,327 R668H probably benign Het
Myo5b G A 18: 74,634,511 E297K possibly damaging Het
Nrg2 A T 18: 36,024,396 L412Q probably damaging Het
Nrtn T C 17: 56,751,473 D176G probably damaging Het
Nrxn1 G T 17: 90,362,906 Q1134K possibly damaging Het
Olfr574 C T 7: 102,949,266 P267L probably damaging Het
Oog4 CAA CA 4: 143,437,452 probably null Het
Pick1 T C 15: 79,255,581 V360A unknown Het
Pigr T A 1: 130,841,666 N71K possibly damaging Het
Ppox T C 1: 171,280,191 N96S probably benign Het
Rasa1 T C 13: 85,228,708 T603A probably benign Het
Rhd T C 4: 134,876,459 L97P probably damaging Het
Sec61a2 T C 2: 5,882,604 I147V probably benign Het
Sh3bp1 C T 15: 78,911,560 P630S probably damaging Het
Sh3d21 T C 4: 126,151,144 T581A probably benign Het
Slc36a2 A G 11: 55,162,672 I380T probably benign Het
Slc36a4 T A 9: 15,726,812 V178D probably damaging Het
Smad7 C A 18: 75,393,835 L251I probably benign Het
Sspo G A 6: 48,449,500 S151N probably benign Het
St3gal4 C T 9: 35,052,253 R253Q probably benign Het
Ttbk1 T C 17: 46,476,931 I242V possibly damaging Het
Ttn G A 2: 76,968,520 A470V unknown Het
Unc13b T C 4: 43,091,258 V28A probably damaging Het
Vmn1r149 A G 7: 22,438,105 V42A possibly damaging Het
Zbtb21 A T 16: 97,951,540 C514* probably null Het
Zfp236 A T 18: 82,644,241 C570* probably null Het
Zfp277 T A 12: 40,329,595 R313S probably damaging Het
Zfp329 A T 7: 12,811,040 C186S probably damaging Het
Zscan4-ps2 A G 7: 11,515,027 probably benign Het
Other mutations in Dact1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03268:Dact1 APN 12 71317483 missense probably damaging 1.00
R0930:Dact1 UTSW 12 71318460 missense probably damaging 1.00
R1590:Dact1 UTSW 12 71317575 missense probably benign 0.34
R1669:Dact1 UTSW 12 71318773 missense probably damaging 1.00
R1694:Dact1 UTSW 12 71312777 missense probably damaging 1.00
R1826:Dact1 UTSW 12 71318344 missense probably damaging 1.00
R4398:Dact1 UTSW 12 71317185 missense probably damaging 1.00
R5028:Dact1 UTSW 12 71318573 nonsense probably null
R5917:Dact1 UTSW 12 71318682 missense possibly damaging 0.75
R6432:Dact1 UTSW 12 71318553 missense probably damaging 1.00
R6473:Dact1 UTSW 12 71317698 missense probably benign 0.00
R6759:Dact1 UTSW 12 71318137 nonsense probably null
R6823:Dact1 UTSW 12 71317939 missense probably benign 0.10
R7776:Dact1 UTSW 12 71317914 missense probably benign
X0025:Dact1 UTSW 12 71317852 missense probably damaging 1.00
Z1177:Dact1 UTSW 12 71310051 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- CAAGAAGTGCCGTTTCCCAG -3'
(R):5'- CTGGGACCAGATTAAACCCC -3'

Sequencing Primer
(F):5'- GTTTCCCAGACGACTCGGATAC -3'
(R):5'- AGATTAAACCCCCGCTCTCCTC -3'
Posted On2019-10-17