Incidental Mutation 'R7564:Rasa1'
ID 585328
Institutional Source Beutler Lab
Gene Symbol Rasa1
Ensembl Gene ENSMUSG00000021549
Gene Name RAS p21 protein activator 1
Synonyms p120-rasGAP, Gap
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7564 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 85214780-85289130 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 85228708 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 603 (T603A)
Ref Sequence ENSEMBL: ENSMUSP00000105179 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109552]
AlphaFold E9PYG6
Predicted Effect probably benign
Transcript: ENSMUST00000109552
AA Change: T603A

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000105179
Gene: ENSMUSG00000021549
AA Change: T603A

DomainStartEndE-ValueType
low complexity region 3 32 N/A INTRINSIC
low complexity region 37 106 N/A INTRINSIC
low complexity region 119 142 N/A INTRINSIC
SH2 170 253 9.44e-29 SMART
SH3 273 331 1.7e-10 SMART
SH2 340 423 7.44e-27 SMART
PH 466 570 5.11e-20 SMART
C2 586 680 6.9e-10 SMART
RasGAP 689 1035 2.77e-156 SMART
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is located in the cytoplasm and is part of the GAP1 family of GTPase-activating proteins. The gene product stimulates the GTPase activity of normal RAS p21 but not its oncogenic counterpart. Acting as a suppressor of RAS function, the protein enhances the weak intrinsic GTPase activity of RAS proteins resulting in the inactive GDP-bound form of RAS, thereby allowing control of cellular proliferation and differentiation. Mutations leading to changes in the binding sites of either protein are associated with basal cell carcinomas. Mutations also have been associated with hereditary capillary malformations (CM) with or without arteriovenous malformations (AVM) and Parkes Weber syndrome. Alternative splicing results in two isoforms where the shorter isoform, lacking the N-terminal hydrophobic region but retaining the same activity, appears to be abundantly expressed in placental but not adult tissues. [provided by RefSeq, May 2012]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced embryonic growth associated with defects of both yolk sac and embryonic vascular systems resulting in lethality by embryonic day 10.5. Mice homozygous for a knock-in allele exhibit increased sensitivity to induced cell death and colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad11 G A 9: 104,123,089 E681K possibly damaging Het
Accsl A T 2: 93,858,156 M411K possibly damaging Het
Amn1 C T 6: 149,185,031 M44I probably benign Het
Bag4 G A 8: 25,777,479 R108* probably null Het
BC037034 C A 5: 138,262,842 probably null Het
C130060K24Rik G T 6: 65,452,907 E196* probably null Het
C87977 C A 4: 144,212,955 C4F probably damaging Het
Cpa1 C T 6: 30,641,768 T197M probably damaging Het
Cyb561d2 A G 9: 107,541,019 V50A probably benign Het
Dact1 A G 12: 71,318,551 D665G probably damaging Het
Dcaf4 G A 12: 83,541,523 V499I probably damaging Het
Depdc5 T G 5: 32,901,510 I274M probably damaging Het
Dnah3 T A 7: 119,971,594 Q2219L probably benign Het
Ect2 A T 3: 27,116,123 probably benign Het
Efcab14 C A 4: 115,759,962 S289R probably benign Het
Fmn2 T C 1: 174,609,574 L1037P unknown Het
Fsip2 G A 2: 82,989,017 M5031I probably benign Het
Gm19410 A G 8: 35,806,997 M1435V probably benign Het
Gm8005 G T 14: 42,439,542 Q44K Het
Hdgfl2 T A 17: 56,099,860 D591E unknown Het
Hk3 C A 13: 55,011,396 C449F probably damaging Het
Hmcn1 T C 1: 150,655,835 M3228V probably benign Het
Kifap3 C T 1: 163,915,768 R773C probably damaging Het
Kndc1 T C 7: 139,920,696 V659A probably benign Het
Lhb C T 7: 45,421,677 R109C probably damaging Het
Lnpep A G 17: 17,578,592 I267T probably benign Het
Lypla1 T A 1: 4,808,367 probably null Het
Map3k21 T C 8: 125,927,708 probably null Het
Mapkbp1 A G 2: 120,013,751 T319A probably benign Het
Mms19 T C 19: 41,947,016 T854A probably benign Het
Mphosph8 A G 14: 56,674,038 T173A probably benign Het
Mtcl1 C T 17: 66,371,327 R668H probably benign Het
Myo5b G A 18: 74,634,511 E297K possibly damaging Het
Nrg2 A T 18: 36,024,396 L412Q probably damaging Het
Nrtn T C 17: 56,751,473 D176G probably damaging Het
Nrxn1 G T 17: 90,362,906 Q1134K possibly damaging Het
Olfr574 C T 7: 102,949,266 P267L probably damaging Het
Oog4 CAA CA 4: 143,437,452 probably null Het
Pick1 T C 15: 79,255,581 V360A unknown Het
Pigr T A 1: 130,841,666 N71K possibly damaging Het
Ppox T C 1: 171,280,191 N96S probably benign Het
Rhd T C 4: 134,876,459 L97P probably damaging Het
Sec61a2 T C 2: 5,882,604 I147V probably benign Het
Sh3bp1 C T 15: 78,911,560 P630S probably damaging Het
Sh3d21 T C 4: 126,151,144 T581A probably benign Het
Slc36a2 A G 11: 55,162,672 I380T probably benign Het
Slc36a4 T A 9: 15,726,812 V178D probably damaging Het
Smad7 C A 18: 75,393,835 L251I probably benign Het
Sspo G A 6: 48,449,500 S151N probably benign Het
St3gal4 C T 9: 35,052,253 R253Q probably benign Het
Ttbk1 T C 17: 46,476,931 I242V possibly damaging Het
Ttn G A 2: 76,968,520 A470V unknown Het
Unc13b T C 4: 43,091,258 V28A probably damaging Het
Vmn1r149 A G 7: 22,438,105 V42A possibly damaging Het
Zbtb21 A T 16: 97,951,540 C514* probably null Het
Zfp236 A T 18: 82,644,241 C570* probably null Het
Zfp277 T A 12: 40,329,595 R313S probably damaging Het
Zfp329 A T 7: 12,811,040 C186S probably damaging Het
Zscan4-ps2 A G 7: 11,515,027 probably benign Het
Other mutations in Rasa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00863:Rasa1 APN 13 85288429 missense probably benign 0.02
IGL01396:Rasa1 APN 13 85258442 missense probably benign 0.10
IGL01670:Rasa1 APN 13 85225490 missense probably damaging 0.97
IGL02095:Rasa1 APN 13 85216155 missense probably benign 0.10
IGL02822:Rasa1 APN 13 85252514 missense probably damaging 0.97
IGL03126:Rasa1 APN 13 85256396 missense possibly damaging 0.94
F5770:Rasa1 UTSW 13 85226945 splice site probably null
PIT4458001:Rasa1 UTSW 13 85227118 missense possibly damaging 0.91
R1393:Rasa1 UTSW 13 85223522 missense probably damaging 1.00
R1441:Rasa1 UTSW 13 85252421 splice site probably null
R1907:Rasa1 UTSW 13 85226572 nonsense probably null
R4243:Rasa1 UTSW 13 85244195 missense probably damaging 1.00
R4593:Rasa1 UTSW 13 85238221 splice site probably null
R4687:Rasa1 UTSW 13 85226635 missense possibly damaging 0.89
R4689:Rasa1 UTSW 13 85238163 nonsense probably null
R4753:Rasa1 UTSW 13 85288390 splice site probably null
R4758:Rasa1 UTSW 13 85234448 missense probably benign
R4774:Rasa1 UTSW 13 85250502 intron probably benign
R5363:Rasa1 UTSW 13 85288555 missense possibly damaging 0.86
R5375:Rasa1 UTSW 13 85288903 intron probably benign
R6134:Rasa1 UTSW 13 85226626 missense probably benign 0.01
R6190:Rasa1 UTSW 13 85233695 missense probably benign 0.02
R6755:Rasa1 UTSW 13 85226598 missense possibly damaging 0.49
R7862:Rasa1 UTSW 13 85255411 missense probably damaging 0.99
R9138:Rasa1 UTSW 13 85221516 missense possibly damaging 0.93
R9280:Rasa1 UTSW 13 85288613 missense unknown
R9328:Rasa1 UTSW 13 85255456 critical splice acceptor site probably null
R9340:Rasa1 UTSW 13 85221530 missense probably damaging 0.98
RF016:Rasa1 UTSW 13 85223488 missense possibly damaging 0.65
X0023:Rasa1 UTSW 13 85233734 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGATGTCAGGAGGAAGATCAC -3'
(R):5'- GATGATGGTAGTTGATTAGCAAAGC -3'

Sequencing Primer
(F):5'- GTTCAGTGTGTTAGATTTAAAACAGG -3'
(R):5'- TCTTTAGGTCAGCAGCCT -3'
Posted On 2019-10-17