Incidental Mutation 'R7564:Ttbk1'
ID585335
Institutional Source Beutler Lab
Gene Symbol Ttbk1
Ensembl Gene ENSMUSG00000015599
Gene Nametau tubulin kinase 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.363) question?
Stock #R7564 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location46442448-46487675 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46476931 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 242 (I242V)
Ref Sequence ENSEMBL: ENSMUSP00000044580 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047034] [ENSMUST00000223818] [ENSMUST00000225808]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047034
AA Change: I242V

PolyPhen 2 Score 0.662 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000044580
Gene: ENSMUSG00000015599
AA Change: I242V

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 34 293 3.4e-21 PFAM
Pfam:Pkinase 34 305 1.7e-33 PFAM
low complexity region 320 334 N/A INTRINSIC
low complexity region 371 395 N/A INTRINSIC
low complexity region 570 593 N/A INTRINSIC
low complexity region 611 624 N/A INTRINSIC
low complexity region 633 653 N/A INTRINSIC
low complexity region 697 709 N/A INTRINSIC
coiled coil region 729 776 N/A INTRINSIC
low complexity region 779 797 N/A INTRINSIC
low complexity region 893 913 N/A INTRINSIC
low complexity region 945 962 N/A INTRINSIC
low complexity region 1090 1115 N/A INTRINSIC
low complexity region 1236 1251 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000223818
Predicted Effect probably benign
Transcript: ENSMUST00000225808
AA Change: I242V

PolyPhen 2 Score 0.424 (Sensitivity: 0.89; Specificity: 0.90)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Summary:This gene belongs to the casein kinase 1 superfamily. The encoded protein is a neuron-specific, serine/threonine and tyrosine kinase, which regulates phosphorylation of tau, a protein that associates with microtubule assemblies and stabilizes them. Genetic variants in this gene are associated with Alzheimer's disease. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad11 G A 9: 104,123,089 E681K possibly damaging Het
Accsl A T 2: 93,858,156 M411K possibly damaging Het
Amn1 C T 6: 149,185,031 M44I probably benign Het
Bag4 G A 8: 25,777,479 R108* probably null Het
BC037034 C A 5: 138,262,842 probably null Het
C130060K24Rik G T 6: 65,452,907 E196* probably null Het
C87977 C A 4: 144,212,955 C4F probably damaging Het
Cpa1 C T 6: 30,641,768 T197M probably damaging Het
Cyb561d2 A G 9: 107,541,019 V50A probably benign Het
Dact1 A G 12: 71,318,551 D665G probably damaging Het
Dcaf4 G A 12: 83,541,523 V499I probably damaging Het
Depdc5 T G 5: 32,901,510 I274M probably damaging Het
Dnah3 T A 7: 119,971,594 Q2219L probably benign Het
Ect2 A T 3: 27,116,123 probably benign Het
Efcab14 C A 4: 115,759,962 S289R probably benign Het
Fmn2 T C 1: 174,609,574 L1037P unknown Het
Fsip2 G A 2: 82,989,017 M5031I probably benign Het
Gm19410 A G 8: 35,806,997 M1435V probably benign Het
Gm8005 G T 14: 42,439,542 Q44K Het
Hdgfl2 T A 17: 56,099,860 D591E unknown Het
Hk3 C A 13: 55,011,396 C449F probably damaging Het
Hmcn1 T C 1: 150,655,835 M3228V probably benign Het
Kifap3 C T 1: 163,915,768 R773C probably damaging Het
Kndc1 T C 7: 139,920,696 V659A probably benign Het
Lhb C T 7: 45,421,677 R109C probably damaging Het
Lnpep A G 17: 17,578,592 I267T probably benign Het
Lypla1 T A 1: 4,808,367 probably null Het
Map3k21 T C 8: 125,927,708 probably null Het
Mapkbp1 A G 2: 120,013,751 T319A probably benign Het
Mms19 T C 19: 41,947,016 T854A probably benign Het
Mphosph8 A G 14: 56,674,038 T173A probably benign Het
Mtcl1 C T 17: 66,371,327 R668H probably benign Het
Myo5b G A 18: 74,634,511 E297K possibly damaging Het
Nrg2 A T 18: 36,024,396 L412Q probably damaging Het
Nrtn T C 17: 56,751,473 D176G probably damaging Het
Nrxn1 G T 17: 90,362,906 Q1134K possibly damaging Het
Olfr574 C T 7: 102,949,266 P267L probably damaging Het
Oog4 CAA CA 4: 143,437,452 probably null Het
Pick1 T C 15: 79,255,581 V360A unknown Het
Pigr T A 1: 130,841,666 N71K possibly damaging Het
Ppox T C 1: 171,280,191 N96S probably benign Het
Rasa1 T C 13: 85,228,708 T603A probably benign Het
Rhd T C 4: 134,876,459 L97P probably damaging Het
Sec61a2 T C 2: 5,882,604 I147V probably benign Het
Sh3bp1 C T 15: 78,911,560 P630S probably damaging Het
Sh3d21 T C 4: 126,151,144 T581A probably benign Het
Slc36a2 A G 11: 55,162,672 I380T probably benign Het
Slc36a4 T A 9: 15,726,812 V178D probably damaging Het
Smad7 C A 18: 75,393,835 L251I probably benign Het
Sspo G A 6: 48,449,500 S151N probably benign Het
St3gal4 C T 9: 35,052,253 R253Q probably benign Het
Ttn G A 2: 76,968,520 A470V unknown Het
Unc13b T C 4: 43,091,258 V28A probably damaging Het
Vmn1r149 A G 7: 22,438,105 V42A possibly damaging Het
Zbtb21 A T 16: 97,951,540 C514* probably null Het
Zfp236 A T 18: 82,644,241 C570* probably null Het
Zfp277 T A 12: 40,329,595 R313S probably damaging Het
Zfp329 A T 7: 12,811,040 C186S probably damaging Het
Zscan4-ps2 A G 7: 11,515,027 probably benign Het
Other mutations in Ttbk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01869:Ttbk1 APN 17 46447063 missense probably damaging 1.00
IGL02469:Ttbk1 APN 17 46470630 missense possibly damaging 0.77
IGL02826:Ttbk1 APN 17 46470660 missense probably benign
IGL02874:Ttbk1 APN 17 46470225 missense probably benign 0.10
IGL02948:Ttbk1 APN 17 46446330 missense probably benign 0.44
IGL03037:Ttbk1 APN 17 46446330 missense probably benign 0.44
R0165:Ttbk1 UTSW 17 46478938 missense possibly damaging 0.70
R1186:Ttbk1 UTSW 17 46467131 missense probably damaging 1.00
R1228:Ttbk1 UTSW 17 46476712 critical splice donor site probably null
R1423:Ttbk1 UTSW 17 46446154 splice site probably benign
R1477:Ttbk1 UTSW 17 46476799 missense probably benign 0.05
R1960:Ttbk1 UTSW 17 46480224 missense probably damaging 0.99
R1961:Ttbk1 UTSW 17 46480224 missense probably damaging 0.99
R4043:Ttbk1 UTSW 17 46446762 missense probably benign 0.21
R4190:Ttbk1 UTSW 17 46479247 missense probably damaging 1.00
R4192:Ttbk1 UTSW 17 46479247 missense probably damaging 1.00
R4193:Ttbk1 UTSW 17 46479247 missense probably damaging 1.00
R4660:Ttbk1 UTSW 17 46477788 nonsense probably null
R5383:Ttbk1 UTSW 17 46467416 missense probably damaging 1.00
R5385:Ttbk1 UTSW 17 46447632 missense probably benign 0.00
R5715:Ttbk1 UTSW 17 46479207 missense probably damaging 0.99
R6218:Ttbk1 UTSW 17 46470807 missense possibly damaging 0.47
R6263:Ttbk1 UTSW 17 46467262 missense probably damaging 1.00
R6471:Ttbk1 UTSW 17 46467277 missense probably benign
R6537:Ttbk1 UTSW 17 46470310 missense probably damaging 0.98
R6552:Ttbk1 UTSW 17 46478962 missense probably benign 0.14
R7853:Ttbk1 UTSW 17 46447343 missense probably benign 0.00
R7871:Ttbk1 UTSW 17 46446238 missense probably benign
R7873:Ttbk1 UTSW 17 46446568 missense probably damaging 1.00
R7908:Ttbk1 UTSW 17 46478938 missense probably damaging 1.00
R8210:Ttbk1 UTSW 17 46480161 missense possibly damaging 0.95
R8236:Ttbk1 UTSW 17 46470729 missense probably damaging 1.00
R8754:Ttbk1 UTSW 17 46445201 nonsense probably null
R8829:Ttbk1 UTSW 17 46446895 missense probably damaging 1.00
R8870:Ttbk1 UTSW 17 46470735 missense probably damaging 1.00
X0066:Ttbk1 UTSW 17 46446856 missense possibly damaging 0.74
Z1088:Ttbk1 UTSW 17 46446325 missense probably benign 0.35
Z1176:Ttbk1 UTSW 17 46460911 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- TAGTCGAGGCTGGCAATGTG -3'
(R):5'- AACCCAGTGTTGTCTATCCGG -3'

Sequencing Primer
(F):5'- AGGCTGGCAATGTGGTCCAG -3'
(R):5'- TGATCAGGGCTCTCTGACAG -3'
Posted On2019-10-17