Incidental Mutation 'R7565:Ncoa2'
ID585345
Institutional Source Beutler Lab
Gene Symbol Ncoa2
Ensembl Gene ENSMUSG00000005886
Gene Namenuclear receptor coactivator 2
SynonymsSRC-2, TIF2, glucocorticoid receptor-interacting protein 1, D1Ertd433e, KAT13C, bHLHe75, TIF2/GRIP-1, TIF-2, Grip1
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_008678.2, NM_001077695.1; MGI: 1276533

Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R7565 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location13139105-13374083 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 13148376 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 1410 (S1410G)
Ref Sequence ENSEMBL: ENSMUSP00000006037 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006037] [ENSMUST00000068304] [ENSMUST00000081713]
PDB Structure Human Estrogen Receptor alpha Ligand-binding Domain in Complex with (R,R)-5,11-cis-diethyl-5,6,11,12-tetrahydrochrysene-2,8-diol and a Glucocorticoid Receptor Interacting Protein 1 NR box II Peptide [X-RAY DIFFRACTION]
STRUCTURAL BASIS FOR BILE ACID BINDING AND ACTIVATION OF THE NUCLEAR RECEPTOR FXR [X-RAY DIFFRACTION]
PPARgamma in complex with a 2-BABA compound [X-RAY DIFFRACTION]
Crystal Structure of Estrogen Receptor alpha Complexed to a B-N Substituted Ligand [X-RAY DIFFRACTION]
Crystal Structure of Estrogen Receptor Alpha mutant 537S Complexed with 4-(6-hydroxy-1H-indazol-3-yl)benzene-1,3-diol [X-RAY DIFFRACTION]
Crystal Structure of the Estrogen Receptor Alpha Ligand Binding Domain Mutant 537S Complexed with Genistein [X-RAY DIFFRACTION]
Crystal Structure of Estrogen Receptor Alpha Ligand Binding Domain Mutant 537S Complexed with an Ethyl Indazole Compound [X-RAY DIFFRACTION]
Crystal Structure of the Estrogen Receptor Alpha Ligand Binding Domain Complexed to an Ether Estradiol Compound [X-RAY DIFFRACTION]
Crystal Structure of the Estrogen Receptor Alpha Ligand Binding Domain Complexed with a Chloro-Indazole Compound [X-RAY DIFFRACTION]
Crystal Structure of the Estrogen Receptor Alpha Ligand Binding Domain Complexed with an Oxabicyclic diarylethylene Compound [X-RAY DIFFRACTION]
>> 8 additional structures at PDB <<
Predicted Effect probably benign
Transcript: ENSMUST00000006037
AA Change: S1410G

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000006037
Gene: ENSMUSG00000005886
AA Change: S1410G

DomainStartEndE-ValueType
HLH 32 89 2.25e-8 SMART
PAS 114 181 4.52e-9 SMART
PAC 334 377 1.13e0 SMART
low complexity region 434 447 N/A INTRINSIC
Pfam:NCOA_u2 463 587 6.7e-39 PFAM
Pfam:SRC-1 636 709 5.8e-23 PFAM
Pfam:DUF4927 731 816 2.7e-33 PFAM
low complexity region 1021 1037 N/A INTRINSIC
Pfam:Nuc_rec_co-act 1071 1117 6.5e-27 PFAM
low complexity region 1183 1204 N/A INTRINSIC
low complexity region 1243 1264 N/A INTRINSIC
DUF1518 1279 1336 5.92e-28 SMART
low complexity region 1409 1420 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000068304
AA Change: S1341G

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000069509
Gene: ENSMUSG00000005886
AA Change: S1341G

DomainStartEndE-ValueType
HLH 32 89 2.25e-8 SMART
PAS 114 181 4.52e-9 SMART
PAC 334 377 1.13e0 SMART
low complexity region 434 447 N/A INTRINSIC
Pfam:SRC-1 636 709 2.2e-28 PFAM
low complexity region 802 813 N/A INTRINSIC
low complexity region 952 968 N/A INTRINSIC
Pfam:Nuc_rec_co-act 1002 1048 1.3e-25 PFAM
low complexity region 1114 1135 N/A INTRINSIC
low complexity region 1174 1195 N/A INTRINSIC
DUF1518 1210 1267 5.92e-28 SMART
low complexity region 1340 1351 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000081713
AA Change: S1341G

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000080413
Gene: ENSMUSG00000005886
AA Change: S1341G

DomainStartEndE-ValueType
HLH 32 89 2.25e-8 SMART
PAS 114 181 4.52e-9 SMART
PAC 334 377 1.13e0 SMART
low complexity region 434 447 N/A INTRINSIC
Pfam:SRC-1 636 709 2.2e-28 PFAM
low complexity region 802 813 N/A INTRINSIC
low complexity region 952 968 N/A INTRINSIC
Pfam:Nuc_rec_co-act 1002 1048 1.3e-25 PFAM
low complexity region 1114 1135 N/A INTRINSIC
low complexity region 1174 1195 N/A INTRINSIC
DUF1518 1210 1267 5.92e-28 SMART
low complexity region 1340 1351 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype Strain: 2183803
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene functions as a transcriptional coactivator for nuclear hormone receptors, including steroid, thyroid, retinoid, and vitamin D receptors. The encoded protein acts as an intermediary factor for the ligand-dependent activity of these nuclear receptors, which regulate their target genes upon binding of cognate response elements. This gene has been found to be involved in translocations that result in fusions with other genes in various cancers, including the lysine acetyltransferase 6A (KAT6A) gene in acute myeloid leukemia, the ETS variant 6 (ETV6) gene in acute lymphoblastic leukemia, and the hes related family bHLH transcription factor with YRPW motif 1 (HEY1) gene in mesenchymal chondrosarcoma. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Homozygous null mice exhibit a transient postnatal growth deficiency and hypofertility. Male hypofertility is due to defects in spermiogenesis and an age-dependent testicular degeneration preceded by defective lipid metabolism in Sertoli cells. Female hypofertility is due to a placental hypoplasia. [provided by MGI curators]
Allele List at MGI

All alleles(43) : Targeted(4) Gene trapped(39)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik A T 1: 26,685,270 N276K probably benign Het
9830107B12Rik T A 17: 48,145,579 Y63F possibly damaging Het
Abi1 A T 2: 22,946,584 I421N probably benign Het
Ahnak A G 19: 9,016,156 I4935V probably benign Het
Atg12 A C 18: 46,734,484 V131G probably damaging Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 CACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGT CACTGGTTCTGTGGTGACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGT 3: 95,888,138 probably benign Het
BC028528 TTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGG TTCTGTGGTCACTGGGTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGG 3: 95,888,144 probably benign Het
Bcl3 C T 7: 19,812,494 V139I probably damaging Het
Bloc1s4 T A 5: 36,748,345 M101L probably benign Het
Bmp6 C T 13: 38,346,257 Q109* probably null Het
Cabyr C T 18: 12,744,599 T28I possibly damaging Het
Catsper3 T C 13: 55,784,725 S22P probably benign Het
Catsperg2 A T 7: 29,712,981 C395S probably null Het
Cd101 T C 3: 101,018,792 T208A probably benign Het
Chaf1a A G 17: 56,064,148 S678G probably benign Het
Chrna2 A C 14: 66,151,035 I500L probably benign Het
Cln6 C T 9: 62,850,757 T266I possibly damaging Het
Col17a1 T A 19: 47,671,524 T330S possibly damaging Het
Cyp2d40 A G 15: 82,760,774 V225A unknown Het
Dnah10 A G 5: 124,799,031 N2645D probably damaging Het
Dph5 T A 3: 115,892,797 V74D probably benign Het
Dthd1 A T 5: 62,843,092 I586L probably damaging Het
Elane G A 10: 79,887,045 R95Q probably benign Het
Fbxw17 A G 13: 50,433,362 T453A probably damaging Het
Fpr3 C A 17: 17,970,965 T166K probably damaging Het
Fryl A G 5: 73,033,720 I2724T probably benign Het
Fsip2 C T 2: 82,949,512 R201C probably damaging Het
Gm14496 T A 2: 181,991,257 F11Y possibly damaging Het
Gm14496 A G 2: 182,000,837 N767S probably damaging Het
Hyal4 T A 6: 24,765,934 M429K possibly damaging Het
Itgad A T 7: 128,183,015 T208S probably damaging Het
Itpr3 T G 17: 27,110,888 L1552R probably benign Het
Kcp C T 6: 29,499,187 C292Y probably damaging Het
Kdr T C 5: 75,948,843 K958R probably damaging Het
Klhl22 T A 16: 17,789,284 W485R probably damaging Het
Ldhb T A 6: 142,492,519 I271F possibly damaging Het
Lmo7 A G 14: 101,885,301 R309G probably damaging Het
Marco C A 1: 120,474,666 C517F probably damaging Het
Mpdz G A 4: 81,303,654 T1423I probably benign Het
Ncor1 T C 11: 62,401,265 N283S probably damaging Het
Nlrp14 T A 7: 107,181,887 L97* probably null Het
Olfm3 T G 3: 115,122,744 S442A probably damaging Het
Olfr116 T C 17: 37,624,501 I45V probably damaging Het
Olfr1436 T C 19: 12,298,848 T95A probably benign Het
Olfr693 T C 7: 106,678,126 Y120C probably damaging Het
Olfr76 T A 19: 12,120,011 S234C probably benign Het
Olfr796 A G 10: 129,608,160 V107A possibly damaging Het
Pank4 G A 4: 154,980,550 V769I probably benign Het
Pdgfrb G A 18: 61,083,264 D1065N probably damaging Het
Ppp1r12a G A 10: 108,268,640 S911N probably benign Het
Prdx6b A G 2: 80,292,990 T48A probably damaging Het
Pttg1ip A G 10: 77,597,036 K166E probably damaging Het
Rabgap1l T C 1: 160,251,417 D9G Het
Rpl13a C T 7: 45,127,042 G69S probably benign Het
Rps6ka5 T A 12: 100,616,083 I177F probably damaging Het
Rttn C A 18: 89,060,479 A1343E probably damaging Het
Ryr2 C T 13: 11,560,653 V4820I possibly damaging Het
Slc12a7 A G 13: 73,790,772 I223V possibly damaging Het
Slc9a3 G A 13: 74,157,694 V277M probably damaging Het
Spata13 A T 14: 60,751,849 Y988F probably damaging Het
Spo11 A G 2: 172,992,071 I329V possibly damaging Het
Tcp11l2 A T 10: 84,587,134 D63V probably damaging Het
Tdrd3 G A 14: 87,506,593 W659* probably null Het
Thnsl2 T C 6: 71,141,327 D39G probably benign Het
Thumpd1 A T 7: 119,716,862 L288* probably null Het
Tram1l1 T C 3: 124,321,907 Y239H probably damaging Het
Usp38 T A 8: 80,981,972 E992D probably damaging Het
Usp45 A G 4: 21,784,790 T159A probably benign Het
Vmn1r218 C T 13: 23,136,660 T59I probably benign Het
Vmn2r70 T C 7: 85,565,291 I218V probably benign Het
Xpr1 T C 1: 155,307,742 I461V probably benign Het
Ydjc T C 16: 17,147,005 L8P probably damaging Het
Yme1l1 A T 2: 23,160,220 N21I possibly damaging Het
Zfhx4 T C 3: 5,390,366 L1140P probably benign Het
Other mutations in Ncoa2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01085:Ncoa2 APN 1 13149079 missense possibly damaging 0.91
IGL01469:Ncoa2 APN 1 13186869 missense probably benign 0.02
IGL01735:Ncoa2 APN 1 13164903 missense probably benign 0.01
IGL01799:Ncoa2 APN 1 13152375 splice site probably benign
IGL02023:Ncoa2 APN 1 13174854 missense probably damaging 1.00
IGL02115:Ncoa2 APN 1 13152817 missense probably damaging 1.00
IGL02263:Ncoa2 APN 1 13174763 missense probably damaging 1.00
IGL03131:Ncoa2 APN 1 13177174 missense probably damaging 0.98
IGL03189:Ncoa2 APN 1 13190136 missense probably damaging 1.00
IGL03240:Ncoa2 APN 1 13177092 missense probably damaging 1.00
Swatch UTSW 1 13181297 missense probably damaging 0.99
R0017:Ncoa2 UTSW 1 13174752 missense probably damaging 1.00
R0056:Ncoa2 UTSW 1 117516497 critical splice donor site probably null
R0158:Ncoa2 UTSW 1 13152384 missense probably benign 0.05
R0164:Ncoa2 UTSW 1 13186731 critical splice donor site probably null
R0164:Ncoa2 UTSW 1 13186731 critical splice donor site probably null
R0684:Ncoa2 UTSW 1 13224651 missense probably damaging 0.99
R0788:Ncoa2 UTSW 1 13166889 splice site probably benign
R1433:Ncoa2 UTSW 1 13148378 missense probably benign 0.01
R1517:Ncoa2 UTSW 1 13165057 missense probably benign 0.33
R1799:Ncoa2 UTSW 1 13162293 splice site probably null
R1959:Ncoa2 UTSW 1 13160252 missense probably damaging 1.00
R2034:Ncoa2 UTSW 1 13164983 missense probably benign 0.00
R2175:Ncoa2 UTSW 1 13224613 missense probably damaging 0.96
R2437:Ncoa2 UTSW 1 13148360 missense probably damaging 0.98
R2851:Ncoa2 UTSW 1 13186889 missense probably damaging 1.00
R2853:Ncoa2 UTSW 1 13186889 missense probably damaging 1.00
R4334:Ncoa2 UTSW 1 13174963 missense possibly damaging 0.77
R4365:Ncoa2 UTSW 1 13180547 missense probably damaging 0.96
R4386:Ncoa2 UTSW 1 13177165 missense probably damaging 0.99
R4516:Ncoa2 UTSW 1 13146906 missense probably damaging 0.99
R5109:Ncoa2 UTSW 1 13186846 missense probably damaging 1.00
R5162:Ncoa2 UTSW 1 13175172 missense possibly damaging 0.79
R5183:Ncoa2 UTSW 1 13174366 missense probably damaging 1.00
R5250:Ncoa2 UTSW 1 13224689 missense probably damaging 1.00
R5514:Ncoa2 UTSW 1 13181221 missense probably damaging 1.00
R5691:Ncoa2 UTSW 1 13180550 missense probably damaging 0.99
R5837:Ncoa2 UTSW 1 13224706 utr 5 prime probably benign
R6003:Ncoa2 UTSW 1 13167030 missense possibly damaging 0.81
R6134:Ncoa2 UTSW 1 13174371 missense probably damaging 1.00
R6559:Ncoa2 UTSW 1 13150617 splice site probably null
R6623:Ncoa2 UTSW 1 13181297 missense probably damaging 0.99
R6949:Ncoa2 UTSW 1 13156501 missense possibly damaging 0.92
R7090:Ncoa2 UTSW 1 13186838 missense probably damaging 1.00
R7251:Ncoa2 UTSW 1 13148375 missense probably benign 0.01
R7389:Ncoa2 UTSW 1 13186825 missense possibly damaging 0.62
R7602:Ncoa2 UTSW 1 13177126 missense possibly damaging 0.95
R7661:Ncoa2 UTSW 1 13174537 missense probably damaging 1.00
R7735:Ncoa2 UTSW 1 13148437 missense probably benign 0.31
R8366:Ncoa2 UTSW 1 13180606 missense probably damaging 1.00
RF021:Ncoa2 UTSW 1 13149109 critical splice acceptor site probably benign
X0063:Ncoa2 UTSW 1 13175238 missense possibly damaging 0.82
X0066:Ncoa2 UTSW 1 13148449 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- GGAGTCCTTCCCAATAGTTCC -3'
(R):5'- AGACTGCCTCAGCTTACCATC -3'

Sequencing Primer
(F):5'- CCAATAGTTCCTTCGTCATTAACAAG -3'
(R):5'- AGCTTACCATCAGACTAACTCTGTC -3'
Posted On2019-10-17