Incidental Mutation 'R7565:Rabgap1l'
ID585349
Institutional Source Beutler Lab
Gene Symbol Rabgap1l
Ensembl Gene ENSMUSG00000026721
Gene NameRAB GTPase activating protein 1-like
SynonymsHh1, 8430421H08Rik, 5830411O09Rik, 9630005B12Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7565 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location160219174-160793211 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 160251417 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 9 (D9G)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028052]
Predicted Effect probably benign
Transcript: ENSMUST00000028052
SMART Domains Protein: ENSMUSP00000028052
Gene: ENSMUSG00000026721

DomainStartEndE-ValueType
Blast:TBC 54 100 8e-16 BLAST
PDB:3HZJ|C 54 130 9e-35 PDB
Blast:TBC 113 176 2e-24 BLAST
low complexity region 188 200 N/A INTRINSIC
coiled coil region 281 340 N/A INTRINSIC
low complexity region 355 366 N/A INTRINSIC
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000193185
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap insertion are viable, fertile and overtly normal with no alterations in hematopoietic progenitor cell numbers or types. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik A T 1: 26,685,270 N276K probably benign Het
9830107B12Rik T A 17: 48,145,579 Y63F possibly damaging Het
Abi1 A T 2: 22,946,584 I421N probably benign Het
Ahnak A G 19: 9,016,156 I4935V probably benign Het
Atg12 A C 18: 46,734,484 V131G probably damaging Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 CACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGT CACTGGTTCTGTGGTGACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGT 3: 95,888,138 probably benign Het
BC028528 TTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGG TTCTGTGGTCACTGGGTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGG 3: 95,888,144 probably benign Het
Bcl3 C T 7: 19,812,494 V139I probably damaging Het
Bloc1s4 T A 5: 36,748,345 M101L probably benign Het
Bmp6 C T 13: 38,346,257 Q109* probably null Het
Cabyr C T 18: 12,744,599 T28I possibly damaging Het
Catsper3 T C 13: 55,784,725 S22P probably benign Het
Catsperg2 A T 7: 29,712,981 C395S probably null Het
Cd101 T C 3: 101,018,792 T208A probably benign Het
Chaf1a A G 17: 56,064,148 S678G probably benign Het
Chrna2 A C 14: 66,151,035 I500L probably benign Het
Cln6 C T 9: 62,850,757 T266I possibly damaging Het
Col17a1 T A 19: 47,671,524 T330S possibly damaging Het
Cyp2d40 A G 15: 82,760,774 V225A unknown Het
Dnah10 A G 5: 124,799,031 N2645D probably damaging Het
Dph5 T A 3: 115,892,797 V74D probably benign Het
Dthd1 A T 5: 62,843,092 I586L probably damaging Het
Elane G A 10: 79,887,045 R95Q probably benign Het
Fbxw17 A G 13: 50,433,362 T453A probably damaging Het
Fpr3 C A 17: 17,970,965 T166K probably damaging Het
Fryl A G 5: 73,033,720 I2724T probably benign Het
Fsip2 C T 2: 82,949,512 R201C probably damaging Het
Gm14496 T A 2: 181,991,257 F11Y possibly damaging Het
Gm14496 A G 2: 182,000,837 N767S probably damaging Het
Hyal4 T A 6: 24,765,934 M429K possibly damaging Het
Itgad A T 7: 128,183,015 T208S probably damaging Het
Itpr3 T G 17: 27,110,888 L1552R probably benign Het
Kcp C T 6: 29,499,187 C292Y probably damaging Het
Kdr T C 5: 75,948,843 K958R probably damaging Het
Klhl22 T A 16: 17,789,284 W485R probably damaging Het
Ldhb T A 6: 142,492,519 I271F possibly damaging Het
Lmo7 A G 14: 101,885,301 R309G probably damaging Het
Marco C A 1: 120,474,666 C517F probably damaging Het
Mpdz G A 4: 81,303,654 T1423I probably benign Het
Ncoa2 T C 1: 13,148,376 S1410G probably benign Het
Ncor1 T C 11: 62,401,265 N283S probably damaging Het
Nlrp14 T A 7: 107,181,887 L97* probably null Het
Olfm3 T G 3: 115,122,744 S442A probably damaging Het
Olfr116 T C 17: 37,624,501 I45V probably damaging Het
Olfr1436 T C 19: 12,298,848 T95A probably benign Het
Olfr693 T C 7: 106,678,126 Y120C probably damaging Het
Olfr76 T A 19: 12,120,011 S234C probably benign Het
Olfr796 A G 10: 129,608,160 V107A possibly damaging Het
Pank4 G A 4: 154,980,550 V769I probably benign Het
Pdgfrb G A 18: 61,083,264 D1065N probably damaging Het
Ppp1r12a G A 10: 108,268,640 S911N probably benign Het
Prdx6b A G 2: 80,292,990 T48A probably damaging Het
Pttg1ip A G 10: 77,597,036 K166E probably damaging Het
Rpl13a C T 7: 45,127,042 G69S probably benign Het
Rps6ka5 T A 12: 100,616,083 I177F probably damaging Het
Rttn C A 18: 89,060,479 A1343E probably damaging Het
Ryr2 C T 13: 11,560,653 V4820I possibly damaging Het
Slc12a7 A G 13: 73,790,772 I223V possibly damaging Het
Slc9a3 G A 13: 74,157,694 V277M probably damaging Het
Spata13 A T 14: 60,751,849 Y988F probably damaging Het
Spo11 A G 2: 172,992,071 I329V possibly damaging Het
Tcp11l2 A T 10: 84,587,134 D63V probably damaging Het
Tdrd3 G A 14: 87,506,593 W659* probably null Het
Thnsl2 T C 6: 71,141,327 D39G probably benign Het
Thumpd1 A T 7: 119,716,862 L288* probably null Het
Tram1l1 T C 3: 124,321,907 Y239H probably damaging Het
Usp38 T A 8: 80,981,972 E992D probably damaging Het
Usp45 A G 4: 21,784,790 T159A probably benign Het
Vmn1r218 C T 13: 23,136,660 T59I probably benign Het
Vmn2r70 T C 7: 85,565,291 I218V probably benign Het
Xpr1 T C 1: 155,307,742 I461V probably benign Het
Ydjc T C 16: 17,147,005 L8P probably damaging Het
Yme1l1 A T 2: 23,160,220 N21I possibly damaging Het
Zfhx4 T C 3: 5,390,366 L1140P probably benign Het
Other mutations in Rabgap1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Rabgap1l APN 1 160738969 missense probably benign 0.02
IGL01309:Rabgap1l APN 1 160700798 missense probably benign 0.00
IGL01448:Rabgap1l APN 1 160740745 splice site probably benign
IGL01886:Rabgap1l APN 1 160342042 missense probably damaging 1.00
IGL02010:Rabgap1l APN 1 160472071 missense probably damaging 0.99
IGL02079:Rabgap1l APN 1 160738970 missense probably benign 0.00
IGL02800:Rabgap1l APN 1 160472053 missense possibly damaging 0.73
IGL03343:Rabgap1l APN 1 160443283 missense probably benign
IGL03388:Rabgap1l APN 1 160733523 splice site probably null
IGL03406:Rabgap1l APN 1 160722169 missense probably damaging 1.00
amerigo UTSW 1 160724036 missense probably damaging 1.00
hispaniola UTSW 1 160645307 critical splice donor site probably null
R0047:Rabgap1l UTSW 1 160231789 splice site probably benign
R0047:Rabgap1l UTSW 1 160231789 splice site probably benign
R0048:Rabgap1l UTSW 1 160627369 splice site probably benign
R0099:Rabgap1l UTSW 1 160682116 missense possibly damaging 0.89
R0201:Rabgap1l UTSW 1 160453745 splice site probably benign
R0432:Rabgap1l UTSW 1 160722205 missense probably benign 0.10
R1104:Rabgap1l UTSW 1 160231875 splice site probably benign
R1220:Rabgap1l UTSW 1 160738909 missense probably damaging 1.00
R1485:Rabgap1l UTSW 1 160733680 missense probably benign 0.06
R1569:Rabgap1l UTSW 1 160702390 missense probably benign 0.08
R1907:Rabgap1l UTSW 1 160645310 missense probably benign 0.07
R2128:Rabgap1l UTSW 1 160738957 missense probably benign 0.00
R2129:Rabgap1l UTSW 1 160738957 missense probably benign 0.00
R2177:Rabgap1l UTSW 1 160724062 missense possibly damaging 0.89
R4636:Rabgap1l UTSW 1 160342090 synonymous probably null
R4722:Rabgap1l UTSW 1 160342164 missense possibly damaging 0.81
R4743:Rabgap1l UTSW 1 160453783 missense probably damaging 1.00
R4913:Rabgap1l UTSW 1 160238541 missense probably damaging 1.00
R4915:Rabgap1l UTSW 1 160441842 missense probably benign 0.01
R5035:Rabgap1l UTSW 1 160724036 missense probably damaging 1.00
R5087:Rabgap1l UTSW 1 160722239 missense probably damaging 1.00
R5437:Rabgap1l UTSW 1 160722147 missense probably damaging 1.00
R5507:Rabgap1l UTSW 1 160351328 missense possibly damaging 0.83
R5619:Rabgap1l UTSW 1 160238572 missense probably benign 0.00
R5691:Rabgap1l UTSW 1 160735684 missense probably damaging 1.00
R5837:Rabgap1l UTSW 1 160307222 utr 3 prime probably benign
R5881:Rabgap1l UTSW 1 160342113 missense probably damaging 1.00
R6045:Rabgap1l UTSW 1 160645323 missense probably benign 0.00
R6243:Rabgap1l UTSW 1 160645307 critical splice donor site probably null
R6294:Rabgap1l UTSW 1 160231849 missense probably benign 0.14
R6452:Rabgap1l UTSW 1 160453761 missense probably damaging 1.00
R6802:Rabgap1l UTSW 1 160733680 missense probably benign 0.06
R6945:Rabgap1l UTSW 1 160682182 missense probably benign 0.29
R7014:Rabgap1l UTSW 1 160342072 missense probably damaging 1.00
R7062:Rabgap1l UTSW 1 160226650 missense probably benign
R7089:Rabgap1l UTSW 1 160724172 nonsense probably null
R7170:Rabgap1l UTSW 1 160645365 missense probably damaging 1.00
R7172:Rabgap1l UTSW 1 160733586 missense probably benign 0.05
R7303:Rabgap1l UTSW 1 160682097 missense probably benign 0.01
R7357:Rabgap1l UTSW 1 160342038 missense probably damaging 1.00
R7466:Rabgap1l UTSW 1 160226484 critical splice donor site probably null
R7501:Rabgap1l UTSW 1 160700788 missense probably damaging 0.98
R7582:Rabgap1l UTSW 1 160682084 missense probably benign
R7740:Rabgap1l UTSW 1 160682103 missense probably benign 0.01
R8116:Rabgap1l UTSW 1 160702442 missense probably benign 0.22
Z1177:Rabgap1l UTSW 1 160739073 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- ATAGCTGGGGAAGTCTGGTTAC -3'
(R):5'- TTGCTAATGTTTCCACACACG -3'

Sequencing Primer
(F):5'- TTTCAGAGACAGACATGAATACAGAC -3'
(R):5'- AATGTTTCCACACACGGCATTTTC -3'
Posted On2019-10-17