Incidental Mutation 'R0619:Zfp764'
ID58535
Institutional Source Beutler Lab
Gene Symbol Zfp764
Ensembl Gene ENSMUSG00000045757
Gene Namezinc finger protein 764
Synonyms
MMRRC Submission 038808-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R0619 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location127403668-127406822 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 127406541 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 22 (V22L)
Ref Sequence ENSEMBL: ENSMUSP00000052944 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059199]
Predicted Effect probably benign
Transcript: ENSMUST00000059199
AA Change: V22L

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000052944
Gene: ENSMUSG00000045757
AA Change: V22L

DomainStartEndE-ValueType
KRAB 22 82 7.33e-31 SMART
low complexity region 102 115 N/A INTRINSIC
ZnF_C2H2 152 174 4.47e-3 SMART
ZnF_C2H2 180 202 1.47e-3 SMART
ZnF_C2H2 208 230 4.3e-5 SMART
ZnF_C2H2 236 258 6.78e-3 SMART
ZnF_C2H2 264 286 1.47e-3 SMART
ZnF_C2H2 292 315 1.45e-2 SMART
ZnF_C2H2 321 343 6.52e-5 SMART
ZnF_C2H2 349 371 6.67e-2 SMART
ZnF_C2H2 377 399 1.67e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139118
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205429
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adad2 G A 8: 119,613,000 D74N probably benign Het
Adgre4 T A 17: 55,820,679 V573D possibly damaging Het
Ak7 A G 12: 105,733,511 K230E probably damaging Het
Amdhd2 T C 17: 24,156,588 D375G possibly damaging Het
Anpep T C 7: 79,841,009 E253G probably benign Het
Bbs7 A G 3: 36,607,576 L158S probably benign Het
BC037034 A G 5: 138,263,826 probably benign Het
Bdp1 T C 13: 100,037,858 T2057A probably benign Het
C2 G T 17: 34,872,503 H61Q probably damaging Het
Ccdc18 A G 5: 108,180,416 K661E probably benign Het
Cdh23 C T 10: 60,433,777 V655I probably damaging Het
Cep78 T C 19: 15,978,862 T238A probably damaging Het
Ces2a T A 8: 104,736,110 N110K probably benign Het
Crat T C 2: 30,409,984 D128G probably benign Het
Dclre1a A T 19: 56,545,409 M233K probably benign Het
Dsg4 T C 18: 20,461,359 V515A probably benign Het
Fer1l6 T C 15: 58,662,935 probably null Het
Fryl T C 5: 73,068,731 D1863G probably benign Het
Fsip2 T A 2: 82,944,140 L57Q probably damaging Het
Gnb4 C T 3: 32,591,207 V112I probably benign Het
Iqsec1 T C 6: 90,670,406 probably null Het
Kcnn3 A C 3: 89,652,030 T536P probably damaging Het
Kctd3 T C 1: 188,978,643 D441G probably damaging Het
Kifc3 G A 8: 95,102,665 T528M probably benign Het
Kmt2c G A 5: 25,298,916 T3798I probably benign Het
Map1a T A 2: 121,305,255 M1946K probably damaging Het
Mfhas1 T A 8: 35,590,675 V768E probably benign Het
Mroh8 C A 2: 157,265,081 V223F possibly damaging Het
Mss51 A T 14: 20,487,573 V30E probably benign Het
Mtmr10 G A 7: 64,321,213 R392H probably benign Het
Mup3 T C 4: 62,085,961 N105S probably benign Het
Myh7b T C 2: 155,611,722 M22T probably benign Het
Olfr1034 T A 2: 86,047,311 Y276* probably null Het
Olfr170 T A 16: 19,606,272 Y132F probably damaging Het
Olfr97 T A 17: 37,232,155 I72F possibly damaging Het
Os9 A G 10: 127,120,991 I43T probably damaging Het
Pkhd1l1 T C 15: 44,483,838 L200P probably damaging Het
Ptpru C T 4: 131,820,887 V100M possibly damaging Het
Rnf6 G A 5: 146,210,721 R496C possibly damaging Het
Rsad1 C T 11: 94,542,639 R407Q probably damaging Het
Rspo3 T C 10: 29,504,637 D127G probably damaging Het
Sbf2 T A 7: 110,310,262 T1760S possibly damaging Het
Sh2d3c T A 2: 32,753,025 V588E probably damaging Het
Siglech A T 7: 55,769,162 T238S probably benign Het
Slc15a2 T A 16: 36,759,307 N328I probably damaging Het
Slc16a11 G T 11: 70,215,032 G94C probably damaging Het
Stub1 T C 17: 25,831,322 probably null Het
Tacc2 T A 7: 130,716,753 V40D probably damaging Het
Tagln3 C A 16: 45,724,272 R12L probably damaging Het
Tsen54 A G 11: 115,815,064 E69G probably damaging Het
Tsks A G 7: 44,950,834 E150G probably damaging Het
Ubap2l A C 3: 90,017,220 V680G probably benign Het
Usp16 A T 16: 87,472,164 H315L probably benign Het
Vav2 A G 2: 27,296,121 probably null Het
Zfc3h1 T C 10: 115,420,810 F1562L possibly damaging Het
Other mutations in Zfp764
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00948:Zfp764 APN 7 127405204 missense possibly damaging 0.93
PIT4514001:Zfp764 UTSW 7 127404741 missense probably benign 0.26
R0528:Zfp764 UTSW 7 127404879 missense possibly damaging 0.92
R1183:Zfp764 UTSW 7 127406247 missense probably damaging 1.00
R1770:Zfp764 UTSW 7 127405567 nonsense probably null
R1878:Zfp764 UTSW 7 127405042 missense probably benign 0.04
R1885:Zfp764 UTSW 7 127405039 missense probably benign
R2181:Zfp764 UTSW 7 127406499 missense probably damaging 1.00
R4780:Zfp764 UTSW 7 127404771 missense probably benign 0.13
R5242:Zfp764 UTSW 7 127405369 missense probably benign
R5493:Zfp764 UTSW 7 127404933 missense probably benign 0.00
R7109:Zfp764 UTSW 7 127404715 missense possibly damaging 0.92
R7214:Zfp764 UTSW 7 127405278 missense probably benign 0.05
R8047:Zfp764 UTSW 7 127406240 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTTTCCCCAGGCAAGTACCCAG -3'
(R):5'- GGTCTTCCTGAAATCTCCGCTGTG -3'

Sequencing Primer
(F):5'- GAGGACAACCCACTTGGTTCC -3'
(R):5'- TTAAGGTGCCCACAGACCTG -3'
Posted On2013-07-11