Incidental Mutation 'R7565:Abi1'
ID585350
Institutional Source Beutler Lab
Gene Symbol Abi1
Ensembl Gene ENSMUSG00000058835
Gene Nameabl-interactor 1
SynonymsE3B1, Ssh3bp1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.772) question?
Stock #R7565 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location22940073-23040241 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 22946584 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 421 (I421N)
Ref Sequence ENSEMBL: ENSMUSP00000118491 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078977] [ENSMUST00000091394] [ENSMUST00000093171] [ENSMUST00000114544] [ENSMUST00000123948] [ENSMUST00000126112] [ENSMUST00000139038] [ENSMUST00000140164] [ENSMUST00000149719] [ENSMUST00000153931] [ENSMUST00000178908]
Predicted Effect possibly damaging
Transcript: ENSMUST00000078977
AA Change: I392N

PolyPhen 2 Score 0.592 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000077997
Gene: ENSMUSG00000058835
AA Change: I392N

DomainStartEndE-ValueType
Pfam:Abi_HHR 93 171 3.7e-38 PFAM
low complexity region 176 185 N/A INTRINSIC
low complexity region 240 258 N/A INTRINSIC
low complexity region 264 282 N/A INTRINSIC
low complexity region 296 303 N/A INTRINSIC
low complexity region 337 364 N/A INTRINSIC
SH3 393 448 2.38e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000091394
AA Change: I420N

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000088957
Gene: ENSMUSG00000058835
AA Change: I420N

DomainStartEndE-ValueType
Pfam:Abi_HHR 93 171 4.1e-38 PFAM
low complexity region 176 185 N/A INTRINSIC
low complexity region 240 258 N/A INTRINSIC
low complexity region 264 281 N/A INTRINSIC
low complexity region 295 302 N/A INTRINSIC
low complexity region 336 351 N/A INTRINSIC
low complexity region 365 392 N/A INTRINSIC
SH3 421 476 2.38e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000093171
AA Change: I391N

PolyPhen 2 Score 0.093 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000090860
Gene: ENSMUSG00000058835
AA Change: I391N

DomainStartEndE-ValueType
Pfam:Abi_HHR 93 171 3.7e-38 PFAM
low complexity region 176 185 N/A INTRINSIC
low complexity region 240 258 N/A INTRINSIC
low complexity region 264 281 N/A INTRINSIC
low complexity region 295 302 N/A INTRINSIC
low complexity region 336 363 N/A INTRINSIC
SH3 392 447 2.38e-23 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000114544
AA Change: I328N

PolyPhen 2 Score 0.548 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000110191
Gene: ENSMUSG00000058835
AA Change: I328N

DomainStartEndE-ValueType
Pfam:Abi_HHR 93 170 4.4e-37 PFAM
low complexity region 171 180 N/A INTRINSIC
low complexity region 235 253 N/A INTRINSIC
low complexity region 268 300 N/A INTRINSIC
SH3 329 384 2.38e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123948
AA Change: I421N

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000118491
Gene: ENSMUSG00000058835
AA Change: I421N

DomainStartEndE-ValueType
Pfam:Abi_HHR 93 170 5.1e-39 PFAM
low complexity region 176 185 N/A INTRINSIC
low complexity region 240 258 N/A INTRINSIC
low complexity region 264 282 N/A INTRINSIC
low complexity region 296 303 N/A INTRINSIC
low complexity region 337 352 N/A INTRINSIC
low complexity region 366 393 N/A INTRINSIC
SH3 422 477 2.38e-23 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000126112
AA Change: I416N

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000117335
Gene: ENSMUSG00000058835
AA Change: I416N

DomainStartEndE-ValueType
Pfam:Abi_HHR 93 170 8.6e-37 PFAM
low complexity region 171 180 N/A INTRINSIC
low complexity region 235 253 N/A INTRINSIC
low complexity region 259 277 N/A INTRINSIC
low complexity region 291 298 N/A INTRINSIC
low complexity region 332 347 N/A INTRINSIC
low complexity region 361 388 N/A INTRINSIC
SH3 417 472 2.38e-23 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000139038
AA Change: I362N

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000116093
Gene: ENSMUSG00000058835
AA Change: I362N

DomainStartEndE-ValueType
Pfam:Abi_HHR 93 171 3.4e-38 PFAM
low complexity region 176 185 N/A INTRINSIC
low complexity region 240 258 N/A INTRINSIC
low complexity region 264 293 N/A INTRINSIC
low complexity region 307 334 N/A INTRINSIC
SH3 363 418 2.38e-23 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000140164
AA Change: I415N

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000120462
Gene: ENSMUSG00000058835
AA Change: I415N

DomainStartEndE-ValueType
Pfam:Abi_HHR 93 170 8.6e-37 PFAM
low complexity region 171 180 N/A INTRINSIC
low complexity region 235 253 N/A INTRINSIC
low complexity region 259 276 N/A INTRINSIC
low complexity region 290 297 N/A INTRINSIC
low complexity region 331 346 N/A INTRINSIC
low complexity region 360 387 N/A INTRINSIC
SH3 416 471 2.38e-23 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000149719
AA Change: I386N

PolyPhen 2 Score 0.578 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000120621
Gene: ENSMUSG00000058835
AA Change: I386N

DomainStartEndE-ValueType
Pfam:Abi_HHR 93 170 7.8e-37 PFAM
low complexity region 171 180 N/A INTRINSIC
low complexity region 235 253 N/A INTRINSIC
low complexity region 259 276 N/A INTRINSIC
low complexity region 290 297 N/A INTRINSIC
low complexity region 331 358 N/A INTRINSIC
SH3 387 442 2.38e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153931
AA Change: I333N

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000120769
Gene: ENSMUSG00000058835
AA Change: I333N

DomainStartEndE-ValueType
Pfam:Abi_HHR 93 171 3e-38 PFAM
low complexity region 176 185 N/A INTRINSIC
low complexity region 240 258 N/A INTRINSIC
low complexity region 273 305 N/A INTRINSIC
SH3 334 389 2.38e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178908
AA Change: I421N

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000136846
Gene: ENSMUSG00000058835
AA Change: I421N

DomainStartEndE-ValueType
Pfam:Abi_HHR 93 171 3.9e-37 PFAM
low complexity region 176 185 N/A INTRINSIC
low complexity region 240 258 N/A INTRINSIC
low complexity region 264 282 N/A INTRINSIC
low complexity region 296 303 N/A INTRINSIC
low complexity region 337 352 N/A INTRINSIC
low complexity region 366 393 N/A INTRINSIC
SH3 422 477 2.38e-23 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Abelson-interactor family of adaptor proteins. These proteins facilitate signal transduction as components of several multiprotein complexes, and regulate actin polymerization and cytoskeletal remodeling through interactions with Abelson tyrosine kinases. The encoded protein plays a role in macropinocytosis as a component of the WAVE2 complex, and also forms a complex with EPS8 and SOS1 that mediates signal transduction from Ras to Rac. This gene may play a role in the progression of several malignancies including melanoma, colon cancer and breast cancer, and a t(10;11) chromosomal translocation involving this gene and the MLL gene has been associated with acute myeloid leukemia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 14. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit background sensitive embryonic lethality prior during organogenesis associated with about abnormal vasculogenesis and angiogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik A T 1: 26,685,270 N276K probably benign Het
9830107B12Rik T A 17: 48,145,579 Y63F possibly damaging Het
Ahnak A G 19: 9,016,156 I4935V probably benign Het
Atg12 A C 18: 46,734,484 V131G probably damaging Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 CACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGT CACTGGTTCTGTGGTGACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGT 3: 95,888,138 probably benign Het
BC028528 TTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGG TTCTGTGGTCACTGGGTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGG 3: 95,888,144 probably benign Het
Bcl3 C T 7: 19,812,494 V139I probably damaging Het
Bloc1s4 T A 5: 36,748,345 M101L probably benign Het
Bmp6 C T 13: 38,346,257 Q109* probably null Het
Cabyr C T 18: 12,744,599 T28I possibly damaging Het
Catsper3 T C 13: 55,784,725 S22P probably benign Het
Catsperg2 A T 7: 29,712,981 C395S probably null Het
Cd101 T C 3: 101,018,792 T208A probably benign Het
Chaf1a A G 17: 56,064,148 S678G probably benign Het
Chrna2 A C 14: 66,151,035 I500L probably benign Het
Cln6 C T 9: 62,850,757 T266I possibly damaging Het
Col17a1 T A 19: 47,671,524 T330S possibly damaging Het
Cyp2d40 A G 15: 82,760,774 V225A unknown Het
Dnah10 A G 5: 124,799,031 N2645D probably damaging Het
Dph5 T A 3: 115,892,797 V74D probably benign Het
Dthd1 A T 5: 62,843,092 I586L probably damaging Het
Elane G A 10: 79,887,045 R95Q probably benign Het
Fbxw17 A G 13: 50,433,362 T453A probably damaging Het
Fpr3 C A 17: 17,970,965 T166K probably damaging Het
Fryl A G 5: 73,033,720 I2724T probably benign Het
Fsip2 C T 2: 82,949,512 R201C probably damaging Het
Gm14496 T A 2: 181,991,257 F11Y possibly damaging Het
Gm14496 A G 2: 182,000,837 N767S probably damaging Het
Hyal4 T A 6: 24,765,934 M429K possibly damaging Het
Itgad A T 7: 128,183,015 T208S probably damaging Het
Itpr3 T G 17: 27,110,888 L1552R probably benign Het
Kcp C T 6: 29,499,187 C292Y probably damaging Het
Kdr T C 5: 75,948,843 K958R probably damaging Het
Klhl22 T A 16: 17,789,284 W485R probably damaging Het
Ldhb T A 6: 142,492,519 I271F possibly damaging Het
Lmo7 A G 14: 101,885,301 R309G probably damaging Het
Marco C A 1: 120,474,666 C517F probably damaging Het
Mpdz G A 4: 81,303,654 T1423I probably benign Het
Ncoa2 T C 1: 13,148,376 S1410G probably benign Het
Ncor1 T C 11: 62,401,265 N283S probably damaging Het
Nlrp14 T A 7: 107,181,887 L97* probably null Het
Olfm3 T G 3: 115,122,744 S442A probably damaging Het
Olfr116 T C 17: 37,624,501 I45V probably damaging Het
Olfr1436 T C 19: 12,298,848 T95A probably benign Het
Olfr693 T C 7: 106,678,126 Y120C probably damaging Het
Olfr76 T A 19: 12,120,011 S234C probably benign Het
Olfr796 A G 10: 129,608,160 V107A possibly damaging Het
Pank4 G A 4: 154,980,550 V769I probably benign Het
Pdgfrb G A 18: 61,083,264 D1065N probably damaging Het
Ppp1r12a G A 10: 108,268,640 S911N probably benign Het
Prdx6b A G 2: 80,292,990 T48A probably damaging Het
Pttg1ip A G 10: 77,597,036 K166E probably damaging Het
Rabgap1l T C 1: 160,251,417 D9G Het
Rpl13a C T 7: 45,127,042 G69S probably benign Het
Rps6ka5 T A 12: 100,616,083 I177F probably damaging Het
Rttn C A 18: 89,060,479 A1343E probably damaging Het
Ryr2 C T 13: 11,560,653 V4820I possibly damaging Het
Slc12a7 A G 13: 73,790,772 I223V possibly damaging Het
Slc9a3 G A 13: 74,157,694 V277M probably damaging Het
Spata13 A T 14: 60,751,849 Y988F probably damaging Het
Spo11 A G 2: 172,992,071 I329V possibly damaging Het
Tcp11l2 A T 10: 84,587,134 D63V probably damaging Het
Tdrd3 G A 14: 87,506,593 W659* probably null Het
Thnsl2 T C 6: 71,141,327 D39G probably benign Het
Thumpd1 A T 7: 119,716,862 L288* probably null Het
Tram1l1 T C 3: 124,321,907 Y239H probably damaging Het
Usp38 T A 8: 80,981,972 E992D probably damaging Het
Usp45 A G 4: 21,784,790 T159A probably benign Het
Vmn1r218 C T 13: 23,136,660 T59I probably benign Het
Vmn2r70 T C 7: 85,565,291 I218V probably benign Het
Xpr1 T C 1: 155,307,742 I461V probably benign Het
Ydjc T C 16: 17,147,005 L8P probably damaging Het
Yme1l1 A T 2: 23,160,220 N21I possibly damaging Het
Zfhx4 T C 3: 5,390,366 L1140P probably benign Het
Other mutations in Abi1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Abi1 APN 2 22941930 missense possibly damaging 0.71
IGL01694:Abi1 APN 2 22960713 missense probably damaging 1.00
IGL01809:Abi1 APN 2 22946717 missense probably benign 0.00
IGL02189:Abi1 APN 2 23040064 start codon destroyed probably null 1.00
IGL03126:Abi1 APN 2 22953467 missense probably benign 0.12
IGL03213:Abi1 APN 2 22941959 missense probably damaging 1.00
IGL03325:Abi1 APN 2 22971228 missense probably damaging 1.00
R0421:Abi1 UTSW 2 22960827 missense probably damaging 1.00
R0505:Abi1 UTSW 2 22962504 splice site probably benign
R1265:Abi1 UTSW 2 22946722 missense possibly damaging 0.85
R1851:Abi1 UTSW 2 22950264 missense possibly damaging 0.78
R2975:Abi1 UTSW 2 22957087 missense probably damaging 0.99
R3416:Abi1 UTSW 2 23040002 missense probably damaging 1.00
R5000:Abi1 UTSW 2 22950199 missense probably damaging 1.00
R5277:Abi1 UTSW 2 22994648 missense probably damaging 1.00
R5945:Abi1 UTSW 2 23039965 missense probably damaging 1.00
R6785:Abi1 UTSW 2 22953467 missense probably benign 0.12
R7000:Abi1 UTSW 2 22942041 missense probably damaging 1.00
R7249:Abi1 UTSW 2 22957089 missense possibly damaging 0.82
R8052:Abi1 UTSW 2 22953543 missense probably benign 0.04
R8252:Abi1 UTSW 2 22971272 splice site probably benign
X0026:Abi1 UTSW 2 22971154 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGCAAGCAAGTTAATCTGAAGC -3'
(R):5'- CTGAATCCTTTTAGTTGCTGATAGC -3'

Sequencing Primer
(F):5'- GCATACATGGTTTGAAAAGATGC -3'
(R):5'- AGTTGCTGATAGCCCAACTC -3'
Posted On2019-10-17