Incidental Mutation 'R7565:BC028528'
ID 585358
Institutional Source Beutler Lab
Gene Symbol BC028528
Ensembl Gene ENSMUSG00000038543
Gene Name cDNA sequence BC028528
Synonyms L259
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock # R7565 (G1)
Quality Score 214.458
Status Not validated
Chromosome 3
Chromosomal Location 95883954-95892005 bp(-) (GRCm38)
Type of Mutation small insertion (5 aa in frame mutation)
DNA Base Change (assembly) CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT to CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT at 95888136 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127666 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036360] [ENSMUST00000090476] [ENSMUST00000171519]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000036360
SMART Domains Protein: ENSMUSP00000046810
Gene: ENSMUSG00000038543

DomainStartEndE-ValueType
Pfam:DUF4634 1 145 3.6e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000090476
SMART Domains Protein: ENSMUSP00000102749
Gene: ENSMUSG00000038543

DomainStartEndE-ValueType
Pfam:DUF4634 1 146 1.8e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171519
SMART Domains Protein: ENSMUSP00000127666
Gene: ENSMUSG00000038543

DomainStartEndE-ValueType
Pfam:DUF4634 1 146 1.5e-65 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik A T 1: 26,685,270 N276K probably benign Het
9830107B12Rik T A 17: 48,145,579 Y63F possibly damaging Het
Abi1 A T 2: 22,946,584 I421N probably benign Het
Ahnak A G 19: 9,016,156 I4935V probably benign Het
Atg12 A C 18: 46,734,484 V131G probably damaging Het
Bcl3 C T 7: 19,812,494 V139I probably damaging Het
Bloc1s4 T A 5: 36,748,345 M101L probably benign Het
Bmp6 C T 13: 38,346,257 Q109* probably null Het
Cabyr C T 18: 12,744,599 T28I possibly damaging Het
Catsper3 T C 13: 55,784,725 S22P probably benign Het
Catsperg2 A T 7: 29,712,981 C395S probably null Het
Cd101 T C 3: 101,018,792 T208A probably benign Het
Chaf1a A G 17: 56,064,148 S678G probably benign Het
Chrna2 A C 14: 66,151,035 I500L probably benign Het
Cln6 C T 9: 62,850,757 T266I possibly damaging Het
Col17a1 T A 19: 47,671,524 T330S possibly damaging Het
Cyp2d40 A G 15: 82,760,774 V225A unknown Het
Dnah10 A G 5: 124,799,031 N2645D probably damaging Het
Dph5 T A 3: 115,892,797 V74D probably benign Het
Dthd1 A T 5: 62,843,092 I586L probably damaging Het
Elane G A 10: 79,887,045 R95Q probably benign Het
Fbxw17 A G 13: 50,433,362 T453A probably damaging Het
Fpr3 C A 17: 17,970,965 T166K probably damaging Het
Fryl A G 5: 73,033,720 I2724T probably benign Het
Fsip2 C T 2: 82,949,512 R201C probably damaging Het
Gm14496 T A 2: 181,991,257 F11Y possibly damaging Het
Gm14496 A G 2: 182,000,837 N767S probably damaging Het
Hyal4 T A 6: 24,765,934 M429K possibly damaging Het
Itgad A T 7: 128,183,015 T208S probably damaging Het
Itpr3 T G 17: 27,110,888 L1552R probably benign Het
Kcp C T 6: 29,499,187 C292Y probably damaging Het
Kdr T C 5: 75,948,843 K958R probably damaging Het
Klhl22 T A 16: 17,789,284 W485R probably damaging Het
Ldhb T A 6: 142,492,519 I271F possibly damaging Het
Lmo7 A G 14: 101,885,301 R309G probably damaging Het
Marco C A 1: 120,474,666 C517F probably damaging Het
Mpdz G A 4: 81,303,654 T1423I probably benign Het
Ncoa2 T C 1: 13,148,376 S1410G probably benign Het
Ncor1 T C 11: 62,401,265 N283S probably damaging Het
Nlrp14 T A 7: 107,181,887 L97* probably null Het
Olfm3 T G 3: 115,122,744 S442A probably damaging Het
Olfr116 T C 17: 37,624,501 I45V probably damaging Het
Olfr1436 T C 19: 12,298,848 T95A probably benign Het
Olfr693 T C 7: 106,678,126 Y120C probably damaging Het
Olfr76 T A 19: 12,120,011 S234C probably benign Het
Olfr796 A G 10: 129,608,160 V107A possibly damaging Het
Pank4 G A 4: 154,980,550 V769I probably benign Het
Pdgfrb G A 18: 61,083,264 D1065N probably damaging Het
Ppp1r12a G A 10: 108,268,640 S911N probably benign Het
Prdx6b A G 2: 80,292,990 T48A probably damaging Het
Pttg1ip A G 10: 77,597,036 K166E probably damaging Het
Rabgap1l T C 1: 160,251,417 D9G Het
Rpl13a C T 7: 45,127,042 G69S probably benign Het
Rps6ka5 T A 12: 100,616,083 I177F probably damaging Het
Rttn C A 18: 89,060,479 A1343E probably damaging Het
Ryr2 C T 13: 11,560,653 V4820I possibly damaging Het
Slc12a7 A G 13: 73,790,772 I223V possibly damaging Het
Slc9a3 G A 13: 74,157,694 V277M probably damaging Het
Spata13 A T 14: 60,751,849 Y988F probably damaging Het
Spo11 A G 2: 172,992,071 I329V possibly damaging Het
Tcp11l2 A T 10: 84,587,134 D63V probably damaging Het
Tdrd3 G A 14: 87,506,593 W659* probably null Het
Thnsl2 T C 6: 71,141,327 D39G probably benign Het
Thumpd1 A T 7: 119,716,862 L288* probably null Het
Tram1l1 T C 3: 124,321,907 Y239H probably damaging Het
Usp38 T A 8: 80,981,972 E992D probably damaging Het
Usp45 A G 4: 21,784,790 T159A probably benign Het
Vmn1r218 C T 13: 23,136,660 T59I probably benign Het
Vmn2r70 T C 7: 85,565,291 I218V probably benign Het
Xpr1 T C 1: 155,307,742 I461V probably benign Het
Ydjc T C 16: 17,147,005 L8P probably damaging Het
Yme1l1 A T 2: 23,160,220 N21I possibly damaging Het
Zfhx4 T C 3: 5,390,366 L1140P probably benign Het
Other mutations in BC028528
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01686:BC028528 APN 3 95888900 missense probably damaging 1.00
R0157:BC028528 UTSW 3 95884968 critical splice donor site probably null
R0164:BC028528 UTSW 3 95887334 intron probably benign
R0306:BC028528 UTSW 3 95889820 unclassified probably benign
R1478:BC028528 UTSW 3 95891959 splice site probably null
R4204:BC028528 UTSW 3 95889745 nonsense probably null
R4649:BC028528 UTSW 3 95888265 missense probably damaging 0.99
R5022:BC028528 UTSW 3 95888823 intron probably benign
R6541:BC028528 UTSW 3 95888218 missense probably benign 0.00
R6683:BC028528 UTSW 3 95888227 missense probably damaging 1.00
R6980:BC028528 UTSW 3 95888136 small insertion probably benign
R6980:BC028528 UTSW 3 95888139 small insertion probably benign
R6980:BC028528 UTSW 3 95888168 small insertion probably benign
R7058:BC028528 UTSW 3 95885011 missense possibly damaging 0.84
R7180:BC028528 UTSW 3 95888136 small insertion probably benign
R7308:BC028528 UTSW 3 95888136 small insertion probably benign
R7308:BC028528 UTSW 3 95888152 small insertion probably benign
R7308:BC028528 UTSW 3 95888169 small insertion probably benign
R7310:BC028528 UTSW 3 95888136 small insertion probably benign
R7310:BC028528 UTSW 3 95888139 small insertion probably benign
R7310:BC028528 UTSW 3 95888148 small insertion probably benign
R7310:BC028528 UTSW 3 95888173 small insertion probably benign
R7356:BC028528 UTSW 3 95888136 small insertion probably benign
R7356:BC028528 UTSW 3 95888141 small insertion probably benign
R7356:BC028528 UTSW 3 95888158 small insertion probably benign
R7356:BC028528 UTSW 3 95888165 small insertion probably benign
R7356:BC028528 UTSW 3 95888175 small insertion probably benign
R7356:BC028528 UTSW 3 95888183 small insertion probably benign
R7376:BC028528 UTSW 3 95888136 small insertion probably benign
R7430:BC028528 UTSW 3 95888136 small insertion probably benign
R7430:BC028528 UTSW 3 95888169 small insertion probably benign
R7490:BC028528 UTSW 3 95888136 small insertion probably benign
R7490:BC028528 UTSW 3 95888166 small insertion probably benign
R7490:BC028528 UTSW 3 95888186 small insertion probably benign
R7491:BC028528 UTSW 3 95888136 small insertion probably benign
R7491:BC028528 UTSW 3 95888138 small insertion probably benign
R7565:BC028528 UTSW 3 95888138 small insertion probably benign
R7565:BC028528 UTSW 3 95888144 small insertion probably benign
R7568:BC028528 UTSW 3 95888136 small insertion probably benign
R7568:BC028528 UTSW 3 95888151 small insertion probably benign
R7568:BC028528 UTSW 3 95888172 small insertion probably benign
R7635:BC028528 UTSW 3 95888136 small insertion probably benign
R7672:BC028528 UTSW 3 95888136 small insertion probably benign
R7672:BC028528 UTSW 3 95888143 small insertion probably benign
R7672:BC028528 UTSW 3 95888175 small insertion probably benign
R7909:BC028528 UTSW 3 95888136 small insertion probably benign
R7909:BC028528 UTSW 3 95888163 small insertion probably benign
R7909:BC028528 UTSW 3 95888164 small insertion probably benign
R7909:BC028528 UTSW 3 95888168 small insertion probably benign
R7909:BC028528 UTSW 3 95888177 small insertion probably benign
R7912:BC028528 UTSW 3 95888136 small insertion probably benign
R7912:BC028528 UTSW 3 95888138 small insertion probably benign
R7912:BC028528 UTSW 3 95888140 small insertion probably benign
R7912:BC028528 UTSW 3 95888142 small insertion probably benign
R7912:BC028528 UTSW 3 95888144 small insertion probably benign
R7912:BC028528 UTSW 3 95888154 small insertion probably benign
R7912:BC028528 UTSW 3 95888171 small insertion probably benign
R7958:BC028528 UTSW 3 95888912 missense probably benign 0.01
R8337:BC028528 UTSW 3 95884986 missense probably benign 0.03
R9288:BC028528 UTSW 3 95891915 missense probably benign 0.00
R9454:BC028528 UTSW 3 95889770 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TAAAGTTGTCCTCTGTCCTCAACAC -3'
(R):5'- TTTCCCAATCCTACCGAGGG -3'

Sequencing Primer
(F):5'- CAATTGGAGAATTGCCTCTGTCAG -3'
(R):5'- TCCTACCGAGGGCAGAACAG -3'
Posted On 2019-10-17