Incidental Mutation 'R7565:Olfm3'
ID585362
Institutional Source Beutler Lab
Gene Symbol Olfm3
Ensembl Gene ENSMUSG00000027965
Gene Nameolfactomedin 3
Synonymsoptimedin, B230206G02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R7565 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location114904078-115125722 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 115122744 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 442 (S442A)
Ref Sequence ENSEMBL: ENSMUSP00000060985 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051309] [ENSMUST00000081752] [ENSMUST00000149158]
Predicted Effect probably damaging
Transcript: ENSMUST00000051309
AA Change: S442A

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000060985
Gene: ENSMUSG00000027965
AA Change: S442A

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Noelin-1 46 145 3.9e-52 PFAM
Blast:OLF 162 207 3e-8 BLAST
OLF 220 470 4.33e-114 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000081752
AA Change: S422A

PolyPhen 2 Score 0.611 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000080448
Gene: ENSMUSG00000027965
AA Change: S422A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Noelin-1 25 125 7.6e-54 PFAM
Blast:OLF 142 187 3e-8 BLAST
OLF 200 450 4.33e-114 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149158
SMART Domains Protein: ENSMUSP00000121097
Gene: ENSMUSG00000027965

DomainStartEndE-ValueType
Pfam:Noelin-1 12 112 2.5e-51 PFAM
Blast:OLF 129 174 1e-8 BLAST
Blast:OLF 187 210 1e-7 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik A T 1: 26,685,270 N276K probably benign Het
9830107B12Rik T A 17: 48,145,579 Y63F possibly damaging Het
Abi1 A T 2: 22,946,584 I421N probably benign Het
Ahnak A G 19: 9,016,156 I4935V probably benign Het
Atg12 A C 18: 46,734,484 V131G probably damaging Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 CACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGT CACTGGTTCTGTGGTGACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGT 3: 95,888,138 probably benign Het
BC028528 TTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGG TTCTGTGGTCACTGGGTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGG 3: 95,888,144 probably benign Het
Bcl3 C T 7: 19,812,494 V139I probably damaging Het
Bloc1s4 T A 5: 36,748,345 M101L probably benign Het
Bmp6 C T 13: 38,346,257 Q109* probably null Het
Cabyr C T 18: 12,744,599 T28I possibly damaging Het
Catsper3 T C 13: 55,784,725 S22P probably benign Het
Catsperg2 A T 7: 29,712,981 C395S probably null Het
Cd101 T C 3: 101,018,792 T208A probably benign Het
Chaf1a A G 17: 56,064,148 S678G probably benign Het
Chrna2 A C 14: 66,151,035 I500L probably benign Het
Cln6 C T 9: 62,850,757 T266I possibly damaging Het
Col17a1 T A 19: 47,671,524 T330S possibly damaging Het
Cyp2d40 A G 15: 82,760,774 V225A unknown Het
Dnah10 A G 5: 124,799,031 N2645D probably damaging Het
Dph5 T A 3: 115,892,797 V74D probably benign Het
Dthd1 A T 5: 62,843,092 I586L probably damaging Het
Elane G A 10: 79,887,045 R95Q probably benign Het
Fbxw17 A G 13: 50,433,362 T453A probably damaging Het
Fpr3 C A 17: 17,970,965 T166K probably damaging Het
Fryl A G 5: 73,033,720 I2724T probably benign Het
Fsip2 C T 2: 82,949,512 R201C probably damaging Het
Gm14496 T A 2: 181,991,257 F11Y possibly damaging Het
Gm14496 A G 2: 182,000,837 N767S probably damaging Het
Hyal4 T A 6: 24,765,934 M429K possibly damaging Het
Itgad A T 7: 128,183,015 T208S probably damaging Het
Itpr3 T G 17: 27,110,888 L1552R probably benign Het
Kcp C T 6: 29,499,187 C292Y probably damaging Het
Kdr T C 5: 75,948,843 K958R probably damaging Het
Klhl22 T A 16: 17,789,284 W485R probably damaging Het
Ldhb T A 6: 142,492,519 I271F possibly damaging Het
Lmo7 A G 14: 101,885,301 R309G probably damaging Het
Marco C A 1: 120,474,666 C517F probably damaging Het
Mpdz G A 4: 81,303,654 T1423I probably benign Het
Ncoa2 T C 1: 13,148,376 S1410G probably benign Het
Ncor1 T C 11: 62,401,265 N283S probably damaging Het
Nlrp14 T A 7: 107,181,887 L97* probably null Het
Olfr116 T C 17: 37,624,501 I45V probably damaging Het
Olfr1436 T C 19: 12,298,848 T95A probably benign Het
Olfr693 T C 7: 106,678,126 Y120C probably damaging Het
Olfr76 T A 19: 12,120,011 S234C probably benign Het
Olfr796 A G 10: 129,608,160 V107A possibly damaging Het
Pank4 G A 4: 154,980,550 V769I probably benign Het
Pdgfrb G A 18: 61,083,264 D1065N probably damaging Het
Ppp1r12a G A 10: 108,268,640 S911N probably benign Het
Prdx6b A G 2: 80,292,990 T48A probably damaging Het
Pttg1ip A G 10: 77,597,036 K166E probably damaging Het
Rabgap1l T C 1: 160,251,417 D9G Het
Rpl13a C T 7: 45,127,042 G69S probably benign Het
Rps6ka5 T A 12: 100,616,083 I177F probably damaging Het
Rttn C A 18: 89,060,479 A1343E probably damaging Het
Ryr2 C T 13: 11,560,653 V4820I possibly damaging Het
Slc12a7 A G 13: 73,790,772 I223V possibly damaging Het
Slc9a3 G A 13: 74,157,694 V277M probably damaging Het
Spata13 A T 14: 60,751,849 Y988F probably damaging Het
Spo11 A G 2: 172,992,071 I329V possibly damaging Het
Tcp11l2 A T 10: 84,587,134 D63V probably damaging Het
Tdrd3 G A 14: 87,506,593 W659* probably null Het
Thnsl2 T C 6: 71,141,327 D39G probably benign Het
Thumpd1 A T 7: 119,716,862 L288* probably null Het
Tram1l1 T C 3: 124,321,907 Y239H probably damaging Het
Usp38 T A 8: 80,981,972 E992D probably damaging Het
Usp45 A G 4: 21,784,790 T159A probably benign Het
Vmn1r218 C T 13: 23,136,660 T59I probably benign Het
Vmn2r70 T C 7: 85,565,291 I218V probably benign Het
Xpr1 T C 1: 155,307,742 I461V probably benign Het
Ydjc T C 16: 17,147,005 L8P probably damaging Het
Yme1l1 A T 2: 23,160,220 N21I possibly damaging Het
Zfhx4 T C 3: 5,390,366 L1140P probably benign Het
Other mutations in Olfm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01656:Olfm3 APN 3 115122633 missense probably damaging 1.00
IGL01686:Olfm3 APN 3 115122848 missense probably benign 0.00
IGL01732:Olfm3 APN 3 115097000 missense possibly damaging 0.82
IGL02539:Olfm3 APN 3 115101930 missense possibly damaging 0.93
IGL02580:Olfm3 APN 3 115122508 missense probably damaging 1.00
IGL02999:Olfm3 APN 3 115122748 missense probably damaging 1.00
IGL03142:Olfm3 APN 3 115097030 missense probably damaging 0.97
IGL03239:Olfm3 APN 3 115122594 missense probably damaging 0.99
R0361:Olfm3 UTSW 3 115120973 missense probably damaging 1.00
R0373:Olfm3 UTSW 3 115122805 missense probably damaging 0.99
R0505:Olfm3 UTSW 3 115122681 missense possibly damaging 0.46
R0689:Olfm3 UTSW 3 115122545 missense probably benign 0.28
R0973:Olfm3 UTSW 3 115101986 missense probably benign 0.00
R0973:Olfm3 UTSW 3 115101986 missense probably benign 0.00
R0974:Olfm3 UTSW 3 115101986 missense probably benign 0.00
R1253:Olfm3 UTSW 3 115122769 missense probably damaging 0.98
R1293:Olfm3 UTSW 3 115101930 missense possibly damaging 0.93
R1952:Olfm3 UTSW 3 115101940 missense probably null 1.00
R2255:Olfm3 UTSW 3 115122193 splice site probably null
R2334:Olfm3 UTSW 3 115101959 nonsense probably null
R2510:Olfm3 UTSW 3 115122310 missense probably damaging 1.00
R4222:Olfm3 UTSW 3 115090171 nonsense probably null
R4716:Olfm3 UTSW 3 115081106 missense probably benign 0.00
R4912:Olfm3 UTSW 3 115101940 missense probably damaging 1.00
R5084:Olfm3 UTSW 3 114904553 critical splice donor site probably null
R5649:Olfm3 UTSW 3 115096924 missense probably damaging 0.99
R5681:Olfm3 UTSW 3 115122275 missense probably benign 0.28
R5861:Olfm3 UTSW 3 115122403 missense probably damaging 1.00
R5924:Olfm3 UTSW 3 115122538 missense probably benign 0.44
R5929:Olfm3 UTSW 3 115101880 missense probably damaging 0.97
R5958:Olfm3 UTSW 3 115122306 missense probably damaging 0.99
R6166:Olfm3 UTSW 3 115122425 missense probably damaging 1.00
R6299:Olfm3 UTSW 3 115120983 missense probably damaging 1.00
R6804:Olfm3 UTSW 3 115122679 missense probably benign 0.10
R7032:Olfm3 UTSW 3 115090156 missense probably damaging 1.00
R7600:Olfm3 UTSW 3 115096940 missense possibly damaging 0.65
R7976:Olfm3 UTSW 3 115081145 missense probably benign 0.00
R8070:Olfm3 UTSW 3 115101955 missense probably damaging 0.96
R8334:Olfm3 UTSW 3 115122557 missense probably damaging 0.96
R8527:Olfm3 UTSW 3 115122547 missense probably benign 0.10
R8542:Olfm3 UTSW 3 115122547 missense probably benign 0.10
Z1088:Olfm3 UTSW 3 114904668 start gained probably benign
Z1177:Olfm3 UTSW 3 115081101 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGAAAAGCTGGAGCACTGGC -3'
(R):5'- CCTTTGCTTTGGAGAAATGATGAC -3'

Sequencing Primer
(F):5'- CTGGCTATCCCAAGAGAAGTGC -3'
(R):5'- TTGCTTTGGAGAAATGATGACAAGCC -3'
Posted On2019-10-17