Incidental Mutation 'R7565:Tram1l1'
ID585364
Institutional Source Beutler Lab
Gene Symbol Tram1l1
Ensembl Gene ENSMUSG00000044528
Gene Nametranslocation associated membrane protein 1-like 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.177) question?
Stock #R7565 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location124320855-124324743 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 124321907 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 239 (Y239H)
Ref Sequence ENSEMBL: ENSMUSP00000062635 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058994]
Predicted Effect probably damaging
Transcript: ENSMUST00000058994
AA Change: Y239H

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000062635
Gene: ENSMUSG00000044528
AA Change: Y239H

DomainStartEndE-ValueType
Pfam:TRAM1 47 114 4.2e-21 PFAM
TLC 116 324 1.73e-47 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik A T 1: 26,685,270 N276K probably benign Het
9830107B12Rik T A 17: 48,145,579 Y63F possibly damaging Het
Abi1 A T 2: 22,946,584 I421N probably benign Het
Ahnak A G 19: 9,016,156 I4935V probably benign Het
Atg12 A C 18: 46,734,484 V131G probably damaging Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 CACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGT CACTGGTTCTGTGGTGACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGT 3: 95,888,138 probably benign Het
BC028528 TTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGG TTCTGTGGTCACTGGGTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGG 3: 95,888,144 probably benign Het
Bcl3 C T 7: 19,812,494 V139I probably damaging Het
Bloc1s4 T A 5: 36,748,345 M101L probably benign Het
Bmp6 C T 13: 38,346,257 Q109* probably null Het
Cabyr C T 18: 12,744,599 T28I possibly damaging Het
Catsper3 T C 13: 55,784,725 S22P probably benign Het
Catsperg2 A T 7: 29,712,981 C395S probably null Het
Cd101 T C 3: 101,018,792 T208A probably benign Het
Chaf1a A G 17: 56,064,148 S678G probably benign Het
Chrna2 A C 14: 66,151,035 I500L probably benign Het
Cln6 C T 9: 62,850,757 T266I possibly damaging Het
Col17a1 T A 19: 47,671,524 T330S possibly damaging Het
Cyp2d40 A G 15: 82,760,774 V225A unknown Het
Dnah10 A G 5: 124,799,031 N2645D probably damaging Het
Dph5 T A 3: 115,892,797 V74D probably benign Het
Dthd1 A T 5: 62,843,092 I586L probably damaging Het
Elane G A 10: 79,887,045 R95Q probably benign Het
Fbxw17 A G 13: 50,433,362 T453A probably damaging Het
Fpr3 C A 17: 17,970,965 T166K probably damaging Het
Fryl A G 5: 73,033,720 I2724T probably benign Het
Fsip2 C T 2: 82,949,512 R201C probably damaging Het
Gm14496 T A 2: 181,991,257 F11Y possibly damaging Het
Gm14496 A G 2: 182,000,837 N767S probably damaging Het
Hyal4 T A 6: 24,765,934 M429K possibly damaging Het
Itgad A T 7: 128,183,015 T208S probably damaging Het
Itpr3 T G 17: 27,110,888 L1552R probably benign Het
Kcp C T 6: 29,499,187 C292Y probably damaging Het
Kdr T C 5: 75,948,843 K958R probably damaging Het
Klhl22 T A 16: 17,789,284 W485R probably damaging Het
Ldhb T A 6: 142,492,519 I271F possibly damaging Het
Lmo7 A G 14: 101,885,301 R309G probably damaging Het
Marco C A 1: 120,474,666 C517F probably damaging Het
Mpdz G A 4: 81,303,654 T1423I probably benign Het
Ncoa2 T C 1: 13,148,376 S1410G probably benign Het
Ncor1 T C 11: 62,401,265 N283S probably damaging Het
Nlrp14 T A 7: 107,181,887 L97* probably null Het
Olfm3 T G 3: 115,122,744 S442A probably damaging Het
Olfr116 T C 17: 37,624,501 I45V probably damaging Het
Olfr1436 T C 19: 12,298,848 T95A probably benign Het
Olfr693 T C 7: 106,678,126 Y120C probably damaging Het
Olfr76 T A 19: 12,120,011 S234C probably benign Het
Olfr796 A G 10: 129,608,160 V107A possibly damaging Het
Pank4 G A 4: 154,980,550 V769I probably benign Het
Pdgfrb G A 18: 61,083,264 D1065N probably damaging Het
Ppp1r12a G A 10: 108,268,640 S911N probably benign Het
Prdx6b A G 2: 80,292,990 T48A probably damaging Het
Pttg1ip A G 10: 77,597,036 K166E probably damaging Het
Rabgap1l T C 1: 160,251,417 D9G Het
Rpl13a C T 7: 45,127,042 G69S probably benign Het
Rps6ka5 T A 12: 100,616,083 I177F probably damaging Het
Rttn C A 18: 89,060,479 A1343E probably damaging Het
Ryr2 C T 13: 11,560,653 V4820I possibly damaging Het
Slc12a7 A G 13: 73,790,772 I223V possibly damaging Het
Slc9a3 G A 13: 74,157,694 V277M probably damaging Het
Spata13 A T 14: 60,751,849 Y988F probably damaging Het
Spo11 A G 2: 172,992,071 I329V possibly damaging Het
Tcp11l2 A T 10: 84,587,134 D63V probably damaging Het
Tdrd3 G A 14: 87,506,593 W659* probably null Het
Thnsl2 T C 6: 71,141,327 D39G probably benign Het
Thumpd1 A T 7: 119,716,862 L288* probably null Het
Usp38 T A 8: 80,981,972 E992D probably damaging Het
Usp45 A G 4: 21,784,790 T159A probably benign Het
Vmn1r218 C T 13: 23,136,660 T59I probably benign Het
Vmn2r70 T C 7: 85,565,291 I218V probably benign Het
Xpr1 T C 1: 155,307,742 I461V probably benign Het
Ydjc T C 16: 17,147,005 L8P probably damaging Het
Yme1l1 A T 2: 23,160,220 N21I possibly damaging Het
Zfhx4 T C 3: 5,390,366 L1140P probably benign Het
Other mutations in Tram1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01293:Tram1l1 APN 3 124322139 missense probably benign 0.00
IGL02385:Tram1l1 APN 3 124322058 missense probably benign 0.25
IGL03212:Tram1l1 APN 3 124321914 missense possibly damaging 0.89
R1440:Tram1l1 UTSW 3 124321931 nonsense probably null
R1929:Tram1l1 UTSW 3 124321986 missense probably damaging 1.00
R2007:Tram1l1 UTSW 3 124321839 missense possibly damaging 0.89
R4623:Tram1l1 UTSW 3 124321860 missense possibly damaging 0.47
R5031:Tram1l1 UTSW 3 124321644 nonsense probably null
R5091:Tram1l1 UTSW 3 124321751 missense possibly damaging 0.69
R6142:Tram1l1 UTSW 3 124321443 missense probably damaging 1.00
R7469:Tram1l1 UTSW 3 124321240 missense probably benign 0.02
R7686:Tram1l1 UTSW 3 124321310 missense probably benign 0.07
R7841:Tram1l1 UTSW 3 124321704 missense probably damaging 1.00
R7841:Tram1l1 UTSW 3 124321705 missense probably damaging 1.00
R8139:Tram1l1 UTSW 3 124321787 missense probably benign 0.10
R8174:Tram1l1 UTSW 3 124322262 missense probably benign 0.00
X0062:Tram1l1 UTSW 3 124322094 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTTTACTTCCAGAAAGTCAGG -3'
(R):5'- AAGGTTCGCGTCTTCTAACC -3'

Sequencing Primer
(F):5'- GAAGCAAGATATCCCGGGTC -3'
(R):5'- CAAGGTCCATGTTATGTACACCTGG -3'
Posted On2019-10-17