Mutagenetix > Incidental Mutations

Incidental Mutation 'R7565:Mpdz'

585366

Institutional Source

Beutler Lab

Gene Symbol

Mpdz

Ensembl Gene

ENSMUSG00000028402

Gene Name

multiple PDZ domain protein

Synonyms

B930003D11Rik, MUPP1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7565 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

81278500-81442815 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 81303654 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 1423 (T1423I)

Ref Sequence

ENSEMBL: ENSMUSP00000102879 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102830] [ENSMUST00000107258] [ENSMUST00000107262] [ENSMUST00000220807]

AlphaFold

Q8VBX6

Predicted Effect

probably benign
Transcript: ENSMUST00000102830
AA Change: T1456I

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000099894
Gene: ENSMUSG00000028402
AA Change: T1456I

Domain	Start	End	E-Value	Type
L27	6	66	9.04e-3	SMART
PDZ	147	225	3.03e-23	SMART
PDZ	266	338	8.92e-21	SMART
low complexity region	345	360	N/A	INTRINSIC
PDZ	386	464	6.07e-23	SMART
PDZ	556	627	7.31e-17	SMART
PDZ	701	780	9.94e-19	SMART
PDZ	1004	1080	3.44e-13	SMART
low complexity region	1111	1126	N/A	INTRINSIC
PDZ	1148	1231	2.43e-22	SMART
low complexity region	1233	1251	N/A	INTRINSIC
PDZ	1346	1421	3.41e-17	SMART
low complexity region	1434	1445	N/A	INTRINSIC
low complexity region	1454	1468	N/A	INTRINSIC
PDZ	1479	1552	2.69e-15	SMART
PDZ	1622	1697	3.2e-22	SMART
PDZ	1719	1792	3.62e-21	SMART
low complexity region	1798	1815	N/A	INTRINSIC
PDZ	1856	1933	9.79e-18	SMART
PDZ	1980	2055	2.39e-21	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000107258
AA Change: T1423I

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000102879
Gene: ENSMUSG00000028402
AA Change: T1423I

Domain	Start	End	E-Value	Type
PDZ	1	73	3.42e-8	SMART
low complexity region	104	119	N/A	INTRINSIC
PDZ	141	224	2.43e-22	SMART
PDZ	306	381	3.41e-17	SMART
low complexity region	394	405	N/A	INTRINSIC
low complexity region	414	428	N/A	INTRINSIC
PDZ	439	512	2.69e-15	SMART
PDZ	582	657	3.2e-22	SMART
PDZ	679	752	3.62e-21	SMART
low complexity region	758	775	N/A	INTRINSIC
PDZ	816	893	9.79e-18	SMART
PDZ	940	1015	2.39e-21	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000107262
AA Change: T1457I

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000102883
Gene: ENSMUSG00000028402
AA Change: T1457I

Domain	Start	End	E-Value	Type
L27	6	66	9.04e-3	SMART
PDZ	147	225	3.03e-23	SMART
PDZ	266	338	8.92e-21	SMART
low complexity region	345	360	N/A	INTRINSIC
PDZ	386	464	6.07e-23	SMART
PDZ	556	627	7.31e-17	SMART
PDZ	701	780	9.94e-19	SMART
PDZ	1004	1080	3.44e-13	SMART
low complexity region	1112	1127	N/A	INTRINSIC
PDZ	1149	1232	2.43e-22	SMART
low complexity region	1234	1252	N/A	INTRINSIC
PDZ	1347	1422	3.41e-17	SMART
low complexity region	1435	1446	N/A	INTRINSIC
low complexity region	1455	1469	N/A	INTRINSIC
PDZ	1480	1553	2.69e-15	SMART
PDZ	1623	1698	3.2e-22	SMART
PDZ	1720	1793	3.62e-21	SMART
low complexity region	1799	1816	N/A	INTRINSIC
PDZ	1857	1934	9.79e-18	SMART
PDZ	1981	2056	2.39e-21	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000131197

SMART Domains

Protein: ENSMUSP00000122498
Gene: ENSMUSG00000028402

Domain	Start	End	E-Value	Type
low complexity region	1	16	N/A	INTRINSIC
PDZ	38	120	1.29e-1	SMART
PDZ	166	241	3.41e-17	SMART
low complexity region	254	265	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000220807
AA Change: T1470I

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has multiple PDZ domains, which are hallmarks of protein-protein interactions. The encoded protein is known to interact with the HTR2C receptor and may cause it to clump at the cell surface. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mutant heterozygous mice are more sensitive to ethanol withdrawal effects and consume less alcohol than controls. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931408C20Rik	A	T	1: 26,685,270	N276K	probably benign	Het
9830107B12Rik	T	A	17: 48,145,579	Y63F	possibly damaging	Het
Abi1	A	T	2: 22,946,584	I421N	probably benign	Het
Ahnak	A	G	19: 9,016,156	I4935V	probably benign	Het
Atg12	A	C	18: 46,734,484	V131G	probably damaging	Het
BC028528	CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT	CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT	3: 95,888,136		probably benign	Het
BC028528	CACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGT	CACTGGTTCTGTGGTGACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGT	3: 95,888,138		probably benign	Het
BC028528	TTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGG	TTCTGTGGTCACTGGGTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGG	3: 95,888,144		probably benign	Het
Bcl3	C	T	7: 19,812,494	V139I	probably damaging	Het
Bloc1s4	T	A	5: 36,748,345	M101L	probably benign	Het
Bmp6	C	T	13: 38,346,257	Q109*	probably null	Het
Cabyr	C	T	18: 12,744,599	T28I	possibly damaging	Het
Catsper3	T	C	13: 55,784,725	S22P	probably benign	Het
Catsperg2	A	T	7: 29,712,981	C395S	probably null	Het
Cd101	T	C	3: 101,018,792	T208A	probably benign	Het
Chaf1a	A	G	17: 56,064,148	S678G	probably benign	Het
Chrna2	A	C	14: 66,151,035	I500L	probably benign	Het
Cln6	C	T	9: 62,850,757	T266I	possibly damaging	Het
Col17a1	T	A	19: 47,671,524	T330S	possibly damaging	Het
Cyp2d40	A	G	15: 82,760,774	V225A	unknown	Het
Dnah10	A	G	5: 124,799,031	N2645D	probably damaging	Het
Dph5	T	A	3: 115,892,797	V74D	probably benign	Het
Dthd1	A	T	5: 62,843,092	I586L	probably damaging	Het
Elane	G	A	10: 79,887,045	R95Q	probably benign	Het
Fbxw17	A	G	13: 50,433,362	T453A	probably damaging	Het
Fpr3	C	A	17: 17,970,965	T166K	probably damaging	Het
Fryl	A	G	5: 73,033,720	I2724T	probably benign	Het
Fsip2	C	T	2: 82,949,512	R201C	probably damaging	Het
Gm14496	T	A	2: 181,991,257	F11Y	possibly damaging	Het
Gm14496	A	G	2: 182,000,837	N767S	probably damaging	Het
Hyal4	T	A	6: 24,765,934	M429K	possibly damaging	Het
Itgad	A	T	7: 128,183,015	T208S	probably damaging	Het
Itpr3	T	G	17: 27,110,888	L1552R	probably benign	Het
Kcp	C	T	6: 29,499,187	C292Y	probably damaging	Het
Kdr	T	C	5: 75,948,843	K958R	probably damaging	Het
Klhl22	T	A	16: 17,789,284	W485R	probably damaging	Het
Ldhb	T	A	6: 142,492,519	I271F	possibly damaging	Het
Lmo7	A	G	14: 101,885,301	R309G	probably damaging	Het
Marco	C	A	1: 120,474,666	C517F	probably damaging	Het
Ncoa2	T	C	1: 13,148,376	S1410G	probably benign	Het
Ncor1	T	C	11: 62,401,265	N283S	probably damaging	Het
Nlrp14	T	A	7: 107,181,887	L97*	probably null	Het
Olfm3	T	G	3: 115,122,744	S442A	probably damaging	Het
Olfr116	T	C	17: 37,624,501	I45V	probably damaging	Het
Olfr1436	T	C	19: 12,298,848	T95A	probably benign	Het
Olfr693	T	C	7: 106,678,126	Y120C	probably damaging	Het
Olfr76	T	A	19: 12,120,011	S234C	probably benign	Het
Olfr796	A	G	10: 129,608,160	V107A	possibly damaging	Het
Pank4	G	A	4: 154,980,550	V769I	probably benign	Het
Pdgfrb	G	A	18: 61,083,264	D1065N	probably damaging	Het
Ppp1r12a	G	A	10: 108,268,640	S911N	probably benign	Het
Prdx6b	A	G	2: 80,292,990	T48A	probably damaging	Het
Pttg1ip	A	G	10: 77,597,036	K166E	probably damaging	Het
Rabgap1l	T	C	1: 160,251,417	D9G		Het
Rpl13a	C	T	7: 45,127,042	G69S	probably benign	Het
Rps6ka5	T	A	12: 100,616,083	I177F	probably damaging	Het
Rttn	C	A	18: 89,060,479	A1343E	probably damaging	Het
Ryr2	C	T	13: 11,560,653	V4820I	possibly damaging	Het
Slc12a7	A	G	13: 73,790,772	I223V	possibly damaging	Het
Slc9a3	G	A	13: 74,157,694	V277M	probably damaging	Het
Spata13	A	T	14: 60,751,849	Y988F	probably damaging	Het
Spo11	A	G	2: 172,992,071	I329V	possibly damaging	Het
Tcp11l2	A	T	10: 84,587,134	D63V	probably damaging	Het
Tdrd3	G	A	14: 87,506,593	W659*	probably null	Het
Thnsl2	T	C	6: 71,141,327	D39G	probably benign	Het
Thumpd1	A	T	7: 119,716,862	L288*	probably null	Het
Tram1l1	T	C	3: 124,321,907	Y239H	probably damaging	Het
Usp38	T	A	8: 80,981,972	E992D	probably damaging	Het
Usp45	A	G	4: 21,784,790	T159A	probably benign	Het
Vmn1r218	C	T	13: 23,136,660	T59I	probably benign	Het
Vmn2r70	T	C	7: 85,565,291	I218V	probably benign	Het
Xpr1	T	C	1: 155,307,742	I461V	probably benign	Het
Ydjc	T	C	16: 17,147,005	L8P	probably damaging	Het
Yme1l1	A	T	2: 23,160,220	N21I	possibly damaging	Het
Zfhx4	T	C	3: 5,390,366	L1140P	probably benign	Het

Other mutations in Mpdz

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Mpdz	APN	4	81310224	nonsense	probably null
IGL00325:Mpdz	APN	4	81317631	missense	probably damaging	1.00
IGL00497:Mpdz	APN	4	81335742	missense	probably benign	0.30
IGL00502:Mpdz	APN	4	81369723	missense	probably damaging	1.00
IGL00539:Mpdz	APN	4	81361351	missense	possibly damaging	0.83
IGL00938:Mpdz	APN	4	81292512	missense	probably damaging	1.00
IGL00990:Mpdz	APN	4	81303584	splice site	probably benign
IGL01394:Mpdz	APN	4	81292491	missense	possibly damaging	0.92
IGL01537:Mpdz	APN	4	81369658	missense	probably damaging	0.98
IGL01558:Mpdz	APN	4	81295530	nonsense	probably null
IGL01561:Mpdz	APN	4	81284614	missense	probably damaging	1.00
IGL01649:Mpdz	APN	4	81303633	missense	probably damaging	0.98
IGL01743:Mpdz	APN	4	81317682	missense	probably damaging	1.00
IGL01941:Mpdz	APN	4	81286387	missense	possibly damaging	0.91
IGL01969:Mpdz	APN	4	81358724	missense	probably damaging	0.98
IGL02023:Mpdz	APN	4	81329529	missense	probably damaging	0.99
IGL02081:Mpdz	APN	4	81335869	missense	probably damaging	1.00
IGL02304:Mpdz	APN	4	81310157	missense	possibly damaging	0.78
IGL02304:Mpdz	APN	4	81297559	splice site	probably benign
IGL02410:Mpdz	APN	4	81297493	missense	probably benign	0.13
IGL02449:Mpdz	APN	4	81329422	splice site	probably null
IGL02671:Mpdz	APN	4	81290273	missense	probably damaging	1.00
IGL02708:Mpdz	APN	4	81284571	splice site	probably null
IGL02718:Mpdz	APN	4	81385202	missense	probably damaging	1.00
IGL03065:Mpdz	APN	4	81292565	missense	probably damaging	0.98
IGL03378:Mpdz	APN	4	81419048	splice site	probably benign
PIT4458001:Mpdz	UTSW	4	81419026	missense	probably damaging	1.00
R0108:Mpdz	UTSW	4	81381805	missense	probably damaging	1.00
R0108:Mpdz	UTSW	4	81381805	missense	probably damaging	1.00
R0119:Mpdz	UTSW	4	81292531	missense	probably benign	0.44
R0402:Mpdz	UTSW	4	81361440	missense	possibly damaging	0.51
R0499:Mpdz	UTSW	4	81292531	missense	probably benign	0.44
R0718:Mpdz	UTSW	4	81292473	missense	possibly damaging	0.79
R0844:Mpdz	UTSW	4	81421194	start gained	probably benign
R0883:Mpdz	UTSW	4	81359991	splice site	probably benign
R0885:Mpdz	UTSW	4	81369592	missense	probably benign	0.04
R1344:Mpdz	UTSW	4	81308319	missense	probably benign	0.01
R1432:Mpdz	UTSW	4	81292551	missense	probably damaging	1.00
R1488:Mpdz	UTSW	4	81348708	nonsense	probably null
R1589:Mpdz	UTSW	4	81421176	missense	probably benign	0.00
R1756:Mpdz	UTSW	4	81306877	missense	possibly damaging	0.87
R1940:Mpdz	UTSW	4	81361443	missense	probably benign	0.01
R2068:Mpdz	UTSW	4	81335830	missense	probably null	1.00
R2182:Mpdz	UTSW	4	81348722	missense	probably damaging	1.00
R2213:Mpdz	UTSW	4	81310172	missense	probably damaging	0.99
R2265:Mpdz	UTSW	4	81383391	missense	probably damaging	1.00
R2268:Mpdz	UTSW	4	81383391	missense	probably damaging	1.00
R2269:Mpdz	UTSW	4	81383391	missense	probably damaging	1.00
R3082:Mpdz	UTSW	4	81285458	splice site	probably benign
R3746:Mpdz	UTSW	4	81363147	missense	probably damaging	1.00
R3902:Mpdz	UTSW	4	81307116	missense	probably damaging	1.00
R4095:Mpdz	UTSW	4	81383823	missense	possibly damaging	0.77
R4097:Mpdz	UTSW	4	81335700	missense	probably damaging	1.00
R4206:Mpdz	UTSW	4	81381762	missense	probably benign	0.13
R4675:Mpdz	UTSW	4	81383812	missense	probably damaging	0.98
R4884:Mpdz	UTSW	4	81361476	missense	probably damaging	0.97
R5044:Mpdz	UTSW	4	81381697	missense	probably benign	0.16
R5050:Mpdz	UTSW	4	81295448	missense	probably benign	0.00
R5243:Mpdz	UTSW	4	81306879	missense	probably damaging	1.00
R5332:Mpdz	UTSW	4	81292580	missense	probably damaging	1.00
R5435:Mpdz	UTSW	4	81283487	intron	probably benign
R5720:Mpdz	UTSW	4	81287694	missense	probably damaging	0.99
R5743:Mpdz	UTSW	4	81421188	start codon destroyed	probably null	0.30
R5764:Mpdz	UTSW	4	81356446	missense	probably benign	0.13
R5876:Mpdz	UTSW	4	81285474	nonsense	probably null
R5938:Mpdz	UTSW	4	81284614	missense	probably damaging	1.00
R5988:Mpdz	UTSW	4	81284575	critical splice donor site	probably null
R6125:Mpdz	UTSW	4	81297527	missense	probably benign	0.00
R6178:Mpdz	UTSW	4	81308365	missense	probably damaging	1.00
R6235:Mpdz	UTSW	4	81385281	missense	probably damaging	1.00
R6293:Mpdz	UTSW	4	81360056	missense	probably damaging	1.00
R6387:Mpdz	UTSW	4	81381709	missense	possibly damaging	0.69
R6488:Mpdz	UTSW	4	81287733	missense	probably benign	0.11
R6536:Mpdz	UTSW	4	81383417	missense	probably damaging	1.00
R6673:Mpdz	UTSW	4	81356430	missense	probably benign	0.11
R6879:Mpdz	UTSW	4	81348656	missense	possibly damaging	0.81
R7180:Mpdz	UTSW	4	81335751	missense	probably damaging	0.98
R7199:Mpdz	UTSW	4	81297333	missense	probably damaging	0.98
R7209:Mpdz	UTSW	4	81306877	missense	possibly damaging	0.87
R7309:Mpdz	UTSW	4	81381958	splice site	probably null
R7359:Mpdz	UTSW	4	81356395	missense	probably benign	0.01
R7561:Mpdz	UTSW	4	81307151	missense	probably damaging	0.99
R7738:Mpdz	UTSW	4	81335749	missense	probably benign	0.01
R7941:Mpdz	UTSW	4	81282750	missense	probably benign	0.04
R8074:Mpdz	UTSW	4	81349087	missense	probably benign	0.00
R8957:Mpdz	UTSW	4	81332979	nonsense	probably null
R8998:Mpdz	UTSW	4	81284645	nonsense	probably null
R8999:Mpdz	UTSW	4	81284645	nonsense	probably null
R9001:Mpdz	UTSW	4	81381762	missense	probably benign
R9223:Mpdz	UTSW	4	81284630	missense	probably damaging	1.00
R9415:Mpdz	UTSW	4	81317668	nonsense	probably null
RF013:Mpdz	UTSW	4	81293592	missense	possibly damaging	0.60
X0011:Mpdz	UTSW	4	81292759	critical splice donor site	probably null
Z1177:Mpdz	UTSW	4	81320490	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TCCACTGACCAGCATCTCAG -3'
(R):5'- TGTTCCAAACACAACGGCTG -3'

Sequencing Primer
(F):5'- ATGACTAGCTCAGGAGTCCTCAG -3'
(R):5'- ACGGCTGTCCAGTCACAC -3'

Posted On

2019-10-17