Incidental Mutation 'R7565:Pank4'
ID585367
Institutional Source Beutler Lab
Gene Symbol Pank4
Ensembl Gene ENSMUSG00000029056
Gene Namepantothenate kinase 4
SynonymsD030031I12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.176) question?
Stock #R7565 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location154964123-154980938 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 154980550 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 769 (V769I)
Ref Sequence ENSEMBL: ENSMUSP00000064330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030931] [ENSMUST00000070953] [ENSMUST00000105631] [ENSMUST00000135665] [ENSMUST00000139976] [ENSMUST00000176194]
Predicted Effect probably benign
Transcript: ENSMUST00000030931
AA Change: V722I

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000030931
Gene: ENSMUSG00000029056
AA Change: V722I

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
Pfam:Fumble 35 369 1.5e-142 PFAM
low complexity region 415 428 N/A INTRINSIC
Pfam:DUF89 451 763 1.4e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000070953
AA Change: V769I

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000064330
Gene: ENSMUSG00000029056
AA Change: V769I

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
Pfam:Fumble 36 367 1.8e-133 PFAM
low complexity region 415 428 N/A INTRINSIC
Pfam:DUF89 451 810 3.1e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105631
SMART Domains Protein: ENSMUSP00000101256
Gene: ENSMUSG00000029055

DomainStartEndE-ValueType
low complexity region 28 45 N/A INTRINSIC
low complexity region 96 107 N/A INTRINSIC
PH 122 231 1.8e-6 SMART
EFh 247 275 7.29e-4 SMART
EFh 283 312 4.67e-2 SMART
Pfam:EF-hand_like 317 399 1.7e-26 PFAM
PLCXc 400 545 6.76e-76 SMART
low complexity region 559 572 N/A INTRINSIC
low complexity region 659 676 N/A INTRINSIC
PLCYc 707 821 1.25e-56 SMART
C2 840 948 1.66e-21 SMART
low complexity region 1088 1107 N/A INTRINSIC
low complexity region 1227 1236 N/A INTRINSIC
low complexity region 1356 1369 N/A INTRINSIC
low complexity region 1421 1451 N/A INTRINSIC
low complexity region 1454 1466 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124517
SMART Domains Protein: ENSMUSP00000122139
Gene: ENSMUSG00000029055

DomainStartEndE-ValueType
C2 1 77 1.58e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135665
SMART Domains Protein: ENSMUSP00000118292
Gene: ENSMUSG00000029055

DomainStartEndE-ValueType
PH 17 126 1.8e-6 SMART
EFh 142 170 7.29e-4 SMART
EFh 178 207 4.67e-2 SMART
Pfam:EF-hand_like 212 294 2.8e-25 PFAM
PLCXc 295 440 6.76e-76 SMART
low complexity region 454 467 N/A INTRINSIC
low complexity region 554 571 N/A INTRINSIC
PLCYc 602 716 1.25e-56 SMART
C2 735 843 1.66e-21 SMART
low complexity region 983 1002 N/A INTRINSIC
low complexity region 1122 1131 N/A INTRINSIC
low complexity region 1251 1264 N/A INTRINSIC
low complexity region 1316 1346 N/A INTRINSIC
low complexity region 1349 1361 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139976
SMART Domains Protein: ENSMUSP00000122704
Gene: ENSMUSG00000029055

DomainStartEndE-ValueType
low complexity region 28 45 N/A INTRINSIC
low complexity region 96 107 N/A INTRINSIC
PH 122 231 1.8e-6 SMART
EFh 247 275 7.29e-4 SMART
EFh 283 312 4.67e-2 SMART
Pfam:EF-hand_like 317 399 3.2e-27 PFAM
PLCXc 400 545 6.76e-76 SMART
low complexity region 559 572 N/A INTRINSIC
low complexity region 659 676 N/A INTRINSIC
PLCYc 707 821 1.25e-56 SMART
C2 840 948 1.66e-21 SMART
low complexity region 1087 1100 N/A INTRINSIC
low complexity region 1166 1194 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148934
SMART Domains Protein: ENSMUSP00000125663
Gene: ENSMUSG00000029056

DomainStartEndE-ValueType
Pfam:Fumble 1 225 2.6e-103 PFAM
low complexity region 273 286 N/A INTRINSIC
Pfam:DUF89 309 472 1.9e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175982
Predicted Effect probably benign
Transcript: ENSMUST00000176194
SMART Domains Protein: ENSMUSP00000134750
Gene: ENSMUSG00000029055

DomainStartEndE-ValueType
PH 21 130 1.8e-6 SMART
EFh 146 174 7.29e-4 SMART
EFh 182 211 4.67e-2 SMART
Pfam:EF-hand_like 216 298 1.6e-25 PFAM
PLCXc 299 444 6.76e-76 SMART
low complexity region 458 471 N/A INTRINSIC
low complexity region 558 575 N/A INTRINSIC
PLCYc 606 720 1.25e-56 SMART
C2 739 847 1.66e-21 SMART
low complexity region 986 999 N/A INTRINSIC
low complexity region 1065 1093 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the pantothenate kinase family. Pantothenate kinase is a key regulatory enzyme in the biosynthesis of coenzyme A (CoA) in bacteria and mammalian cells. It catalyzes the first committed step in the universal biosynthetic pathway leading to CoA and is itself subject to regulation through feedback inhibition by CoA. This family member is most abundant in muscle but is expressed in all tissues. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik A T 1: 26,685,270 N276K probably benign Het
9830107B12Rik T A 17: 48,145,579 Y63F possibly damaging Het
Abi1 A T 2: 22,946,584 I421N probably benign Het
Ahnak A G 19: 9,016,156 I4935V probably benign Het
Atg12 A C 18: 46,734,484 V131G probably damaging Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 CACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGT CACTGGTTCTGTGGTGACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGT 3: 95,888,138 probably benign Het
BC028528 TTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGG TTCTGTGGTCACTGGGTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGG 3: 95,888,144 probably benign Het
Bcl3 C T 7: 19,812,494 V139I probably damaging Het
Bloc1s4 T A 5: 36,748,345 M101L probably benign Het
Bmp6 C T 13: 38,346,257 Q109* probably null Het
Cabyr C T 18: 12,744,599 T28I possibly damaging Het
Catsper3 T C 13: 55,784,725 S22P probably benign Het
Catsperg2 A T 7: 29,712,981 C395S probably null Het
Cd101 T C 3: 101,018,792 T208A probably benign Het
Chaf1a A G 17: 56,064,148 S678G probably benign Het
Chrna2 A C 14: 66,151,035 I500L probably benign Het
Cln6 C T 9: 62,850,757 T266I possibly damaging Het
Col17a1 T A 19: 47,671,524 T330S possibly damaging Het
Cyp2d40 A G 15: 82,760,774 V225A unknown Het
Dnah10 A G 5: 124,799,031 N2645D probably damaging Het
Dph5 T A 3: 115,892,797 V74D probably benign Het
Dthd1 A T 5: 62,843,092 I586L probably damaging Het
Elane G A 10: 79,887,045 R95Q probably benign Het
Fbxw17 A G 13: 50,433,362 T453A probably damaging Het
Fpr3 C A 17: 17,970,965 T166K probably damaging Het
Fryl A G 5: 73,033,720 I2724T probably benign Het
Fsip2 C T 2: 82,949,512 R201C probably damaging Het
Gm14496 T A 2: 181,991,257 F11Y possibly damaging Het
Gm14496 A G 2: 182,000,837 N767S probably damaging Het
Hyal4 T A 6: 24,765,934 M429K possibly damaging Het
Itgad A T 7: 128,183,015 T208S probably damaging Het
Itpr3 T G 17: 27,110,888 L1552R probably benign Het
Kcp C T 6: 29,499,187 C292Y probably damaging Het
Kdr T C 5: 75,948,843 K958R probably damaging Het
Klhl22 T A 16: 17,789,284 W485R probably damaging Het
Ldhb T A 6: 142,492,519 I271F possibly damaging Het
Lmo7 A G 14: 101,885,301 R309G probably damaging Het
Marco C A 1: 120,474,666 C517F probably damaging Het
Mpdz G A 4: 81,303,654 T1423I probably benign Het
Ncoa2 T C 1: 13,148,376 S1410G probably benign Het
Ncor1 T C 11: 62,401,265 N283S probably damaging Het
Nlrp14 T A 7: 107,181,887 L97* probably null Het
Olfm3 T G 3: 115,122,744 S442A probably damaging Het
Olfr116 T C 17: 37,624,501 I45V probably damaging Het
Olfr1436 T C 19: 12,298,848 T95A probably benign Het
Olfr693 T C 7: 106,678,126 Y120C probably damaging Het
Olfr76 T A 19: 12,120,011 S234C probably benign Het
Olfr796 A G 10: 129,608,160 V107A possibly damaging Het
Pdgfrb G A 18: 61,083,264 D1065N probably damaging Het
Ppp1r12a G A 10: 108,268,640 S911N probably benign Het
Prdx6b A G 2: 80,292,990 T48A probably damaging Het
Pttg1ip A G 10: 77,597,036 K166E probably damaging Het
Rabgap1l T C 1: 160,251,417 D9G Het
Rpl13a C T 7: 45,127,042 G69S probably benign Het
Rps6ka5 T A 12: 100,616,083 I177F probably damaging Het
Rttn C A 18: 89,060,479 A1343E probably damaging Het
Ryr2 C T 13: 11,560,653 V4820I possibly damaging Het
Slc12a7 A G 13: 73,790,772 I223V possibly damaging Het
Slc9a3 G A 13: 74,157,694 V277M probably damaging Het
Spata13 A T 14: 60,751,849 Y988F probably damaging Het
Spo11 A G 2: 172,992,071 I329V possibly damaging Het
Tcp11l2 A T 10: 84,587,134 D63V probably damaging Het
Tdrd3 G A 14: 87,506,593 W659* probably null Het
Thnsl2 T C 6: 71,141,327 D39G probably benign Het
Thumpd1 A T 7: 119,716,862 L288* probably null Het
Tram1l1 T C 3: 124,321,907 Y239H probably damaging Het
Usp38 T A 8: 80,981,972 E992D probably damaging Het
Usp45 A G 4: 21,784,790 T159A probably benign Het
Vmn1r218 C T 13: 23,136,660 T59I probably benign Het
Vmn2r70 T C 7: 85,565,291 I218V probably benign Het
Xpr1 T C 1: 155,307,742 I461V probably benign Het
Ydjc T C 16: 17,147,005 L8P probably damaging Het
Yme1l1 A T 2: 23,160,220 N21I possibly damaging Het
Zfhx4 T C 3: 5,390,366 L1140P probably benign Het
Other mutations in Pank4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00822:Pank4 APN 4 154980602 missense possibly damaging 0.50
IGL01105:Pank4 APN 4 154972465 splice site probably benign
IGL01291:Pank4 APN 4 154974646 missense probably damaging 0.98
IGL01935:Pank4 APN 4 154979530 missense probably damaging 1.00
IGL02366:Pank4 APN 4 154969628 missense probably benign 0.03
IGL02514:Pank4 APN 4 154970465 missense probably damaging 0.99
IGL03028:Pank4 APN 4 154969985 unclassified probably benign
IGL03033:Pank4 APN 4 154974715 missense probably damaging 1.00
ANU05:Pank4 UTSW 4 154974646 missense probably damaging 0.98
R0518:Pank4 UTSW 4 154976625 missense possibly damaging 0.90
R1196:Pank4 UTSW 4 154978173 missense probably damaging 0.99
R1566:Pank4 UTSW 4 154980521 missense probably damaging 0.98
R1581:Pank4 UTSW 4 154974651 missense probably damaging 1.00
R1709:Pank4 UTSW 4 154970047 missense probably damaging 1.00
R1852:Pank4 UTSW 4 154976359 missense probably damaging 1.00
R1950:Pank4 UTSW 4 154972520 missense probably benign
R2943:Pank4 UTSW 4 154971474 missense probably benign 0.01
R3911:Pank4 UTSW 4 154969601 missense probably damaging 1.00
R4162:Pank4 UTSW 4 154979594 critical splice donor site probably null
R4404:Pank4 UTSW 4 154980156 missense probably benign 0.00
R4619:Pank4 UTSW 4 154976619 missense probably benign 0.07
R4731:Pank4 UTSW 4 154971390 missense probably benign 0.01
R4732:Pank4 UTSW 4 154971390 missense probably benign 0.01
R4733:Pank4 UTSW 4 154971390 missense probably benign 0.01
R4747:Pank4 UTSW 4 154979532 missense probably damaging 1.00
R4760:Pank4 UTSW 4 154974634 missense possibly damaging 0.60
R5218:Pank4 UTSW 4 154979728 missense probably benign 0.01
R5278:Pank4 UTSW 4 154972165 missense probably damaging 1.00
R5774:Pank4 UTSW 4 154980662 missense probably damaging 1.00
R6004:Pank4 UTSW 4 154977221 missense probably damaging 1.00
R6376:Pank4 UTSW 4 154972236 splice site probably null
R7105:Pank4 UTSW 4 154980167 missense probably benign 0.07
R7253:Pank4 UTSW 4 154970920 missense probably benign 0.02
R7481:Pank4 UTSW 4 154970038 missense probably damaging 1.00
R7718:Pank4 UTSW 4 154974643 missense probably damaging 1.00
R7736:Pank4 UTSW 4 154969747 missense probably benign 0.03
R8144:Pank4 UTSW 4 154970080 missense probably benign 0.01
Z1177:Pank4 UTSW 4 154974745 missense probably damaging 1.00
Z1177:Pank4 UTSW 4 154974784 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- ATGCCTCAGTTAGCAAGGGG -3'
(R):5'- TCCTGATGAGGGATATGCAGAC -3'

Sequencing Primer
(F):5'- GTGCTGGGGAAAGGTCC -3'
(R):5'- CACGTCTGGCAGAGTGGGTATC -3'
Posted On2019-10-17