Incidental Mutation 'R0619:Mfhas1'
ID58537
Institutional Source Beutler Lab
Gene Symbol Mfhas1
Ensembl Gene ENSMUSG00000070056
Gene Namemalignant fibrous histiocytoma amplified sequence 1
Synonyms2310066G09Rik, D8Ertd91e
MMRRC Submission 038808-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.233) question?
Stock #R0619 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location35587798-35679449 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 35590675 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 768 (V768E)
Ref Sequence ENSEMBL: ENSMUSP00000044135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037666]
Predicted Effect probably benign
Transcript: ENSMUST00000037666
AA Change: V768E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000044135
Gene: ENSMUSG00000070056
AA Change: V768E

DomainStartEndE-ValueType
LRR 58 81 1.97e1 SMART
LRR 82 105 5.72e-1 SMART
LRR 106 125 2.79e1 SMART
LRR 130 152 8.09e-1 SMART
LRR_TYP 153 175 7.78e-3 SMART
LRR 176 195 5.48e0 SMART
LRR 199 221 6.57e-1 SMART
LRR 222 244 3.98e1 SMART
LRR 245 267 1.25e-1 SMART
LRR 268 290 3.27e1 SMART
LRR 291 313 1.43e-1 SMART
LRR 314 334 1.12e1 SMART
LRR_TYP 337 360 4.11e-2 SMART
Pfam:Roc 407 537 6.9e-11 PFAM
low complexity region 743 750 N/A INTRINSIC
low complexity region 754 761 N/A INTRINSIC
low complexity region 808 820 N/A INTRINSIC
Blast:LY 1018 1038 7e-6 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181322
Predicted Effect unknown
Transcript: ENSMUST00000209953
AA Change: V573E
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Identified in a human 8p amplicon, this gene is a potential oncogene whose expression is enhanced in some malignant fibrous histiocytomas (MFH). The primary structure of its product includes an ATP/GTP-binding site, three leucine zipper domains, and a leucine-rich tandem repeat, which are structural or functional elements for interactions among proteins related to the cell cycle, and which suggest that overexpression might be oncogenic with respect to MFH. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adad2 G A 8: 119,613,000 D74N probably benign Het
Adgre4 T A 17: 55,820,679 V573D possibly damaging Het
Ak7 A G 12: 105,733,511 K230E probably damaging Het
Amdhd2 T C 17: 24,156,588 D375G possibly damaging Het
Anpep T C 7: 79,841,009 E253G probably benign Het
Bbs7 A G 3: 36,607,576 L158S probably benign Het
BC037034 A G 5: 138,263,826 probably benign Het
Bdp1 T C 13: 100,037,858 T2057A probably benign Het
C2 G T 17: 34,872,503 H61Q probably damaging Het
Ccdc18 A G 5: 108,180,416 K661E probably benign Het
Cdh23 C T 10: 60,433,777 V655I probably damaging Het
Cep78 T C 19: 15,978,862 T238A probably damaging Het
Ces2a T A 8: 104,736,110 N110K probably benign Het
Crat T C 2: 30,409,984 D128G probably benign Het
Dclre1a A T 19: 56,545,409 M233K probably benign Het
Dsg4 T C 18: 20,461,359 V515A probably benign Het
Fer1l6 T C 15: 58,662,935 probably null Het
Fryl T C 5: 73,068,731 D1863G probably benign Het
Fsip2 T A 2: 82,944,140 L57Q probably damaging Het
Gnb4 C T 3: 32,591,207 V112I probably benign Het
Iqsec1 T C 6: 90,670,406 probably null Het
Kcnn3 A C 3: 89,652,030 T536P probably damaging Het
Kctd3 T C 1: 188,978,643 D441G probably damaging Het
Kifc3 G A 8: 95,102,665 T528M probably benign Het
Kmt2c G A 5: 25,298,916 T3798I probably benign Het
Map1a T A 2: 121,305,255 M1946K probably damaging Het
Mroh8 C A 2: 157,265,081 V223F possibly damaging Het
Mss51 A T 14: 20,487,573 V30E probably benign Het
Mtmr10 G A 7: 64,321,213 R392H probably benign Het
Mup3 T C 4: 62,085,961 N105S probably benign Het
Myh7b T C 2: 155,611,722 M22T probably benign Het
Olfr1034 T A 2: 86,047,311 Y276* probably null Het
Olfr170 T A 16: 19,606,272 Y132F probably damaging Het
Olfr97 T A 17: 37,232,155 I72F possibly damaging Het
Os9 A G 10: 127,120,991 I43T probably damaging Het
Pkhd1l1 T C 15: 44,483,838 L200P probably damaging Het
Ptpru C T 4: 131,820,887 V100M possibly damaging Het
Rnf6 G A 5: 146,210,721 R496C possibly damaging Het
Rsad1 C T 11: 94,542,639 R407Q probably damaging Het
Rspo3 T C 10: 29,504,637 D127G probably damaging Het
Sbf2 T A 7: 110,310,262 T1760S possibly damaging Het
Sh2d3c T A 2: 32,753,025 V588E probably damaging Het
Siglech A T 7: 55,769,162 T238S probably benign Het
Slc15a2 T A 16: 36,759,307 N328I probably damaging Het
Slc16a11 G T 11: 70,215,032 G94C probably damaging Het
Stub1 T C 17: 25,831,322 probably null Het
Tacc2 T A 7: 130,716,753 V40D probably damaging Het
Tagln3 C A 16: 45,724,272 R12L probably damaging Het
Tsen54 A G 11: 115,815,064 E69G probably damaging Het
Tsks A G 7: 44,950,834 E150G probably damaging Het
Ubap2l A C 3: 90,017,220 V680G probably benign Het
Usp16 A T 16: 87,472,164 H315L probably benign Het
Vav2 A G 2: 27,296,121 probably null Het
Zfc3h1 T C 10: 115,420,810 F1562L possibly damaging Het
Zfp764 C A 7: 127,406,541 V22L probably benign Het
Other mutations in Mfhas1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00694:Mfhas1 APN 8 35590771 missense probably benign 0.00
IGL00841:Mfhas1 APN 8 35590886 missense probably damaging 0.97
IGL01548:Mfhas1 APN 8 35590459 missense probably damaging 1.00
IGL02031:Mfhas1 APN 8 35589372 missense probably damaging 0.99
IGL02093:Mfhas1 APN 8 35589344 missense probably damaging 1.00
IGL02314:Mfhas1 APN 8 35588773 missense probably damaging 0.98
IGL02412:Mfhas1 APN 8 35588815 missense probably benign 0.11
IGL02638:Mfhas1 APN 8 35590950 missense possibly damaging 0.55
IGL02663:Mfhas1 APN 8 35589906 missense probably damaging 0.99
R0545:Mfhas1 UTSW 8 35589048 missense probably damaging 1.00
R0637:Mfhas1 UTSW 8 35590026 nonsense probably null
R1251:Mfhas1 UTSW 8 35591053 missense probably damaging 0.97
R1829:Mfhas1 UTSW 8 35590068 missense probably benign
R1829:Mfhas1 UTSW 8 35590248 missense probably benign 0.09
R1839:Mfhas1 UTSW 8 35590858 missense possibly damaging 0.95
R1934:Mfhas1 UTSW 8 35591097 missense possibly damaging 0.52
R1937:Mfhas1 UTSW 8 35589645 missense probably damaging 0.99
R2038:Mfhas1 UTSW 8 35591277 missense probably damaging 1.00
R2982:Mfhas1 UTSW 8 35591115 missense probably benign 0.07
R4566:Mfhas1 UTSW 8 35591049 missense probably damaging 1.00
R4604:Mfhas1 UTSW 8 35588610 missense probably benign 0.00
R4693:Mfhas1 UTSW 8 35589175 missense probably damaging 1.00
R5205:Mfhas1 UTSW 8 35591007 missense probably benign 0.10
R5535:Mfhas1 UTSW 8 35590269 missense possibly damaging 0.73
R5631:Mfhas1 UTSW 8 35588419 missense probably damaging 0.96
R5744:Mfhas1 UTSW 8 35589482 missense probably damaging 1.00
R6580:Mfhas1 UTSW 8 35589265 missense probably damaging 1.00
R6663:Mfhas1 UTSW 8 35589118 missense probably damaging 1.00
R6998:Mfhas1 UTSW 8 35591356 missense probably damaging 1.00
R7046:Mfhas1 UTSW 8 35664790 missense probably benign 0.00
R7054:Mfhas1 UTSW 8 35588638 missense probably benign 0.30
R7171:Mfhas1 UTSW 8 35588992 missense probably benign 0.08
R7396:Mfhas1 UTSW 8 35590199 missense probably damaging 0.97
R7557:Mfhas1 UTSW 8 35589604 missense possibly damaging 0.50
R7853:Mfhas1 UTSW 8 35589871 nonsense probably null
R7876:Mfhas1 UTSW 8 35589543 missense probably damaging 1.00
R7936:Mfhas1 UTSW 8 35589871 nonsense probably null
R7959:Mfhas1 UTSW 8 35589543 missense probably damaging 1.00
X0060:Mfhas1 UTSW 8 35588404 missense possibly damaging 0.52
Z1088:Mfhas1 UTSW 8 35590236 missense probably benign 0.04
Z1177:Mfhas1 UTSW 8 35590385
Predicted Primers PCR Primer
(F):5'- GGAGCATGTCTTCCACAACCTCAC -3'
(R):5'- TCATTCTGCACGTAGCATGGGAAC -3'

Sequencing Primer
(F):5'- ACCCGCCTCATTGACATC -3'
(R):5'- ATGGGAACTTGTACCATGCC -3'
Posted On2013-07-11