Incidental Mutation 'R7565:Fryl'
ID585370
Institutional Source Beutler Lab
Gene Symbol Fryl
Ensembl Gene ENSMUSG00000070733
Gene NameFRY like transcription coactivator
Synonyms2510002A14Rik, 2310004H21Rik, 9030227G01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.785) question?
Stock #R7565 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location73019987-73256619 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73033720 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 2724 (I2724T)
Ref Sequence ENSEMBL: ENSMUSP00000092289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094700] [ENSMUST00000101127]
Predicted Effect probably benign
Transcript: ENSMUST00000094700
AA Change: I2724T

PolyPhen 2 Score 0.180 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000092289
Gene: ENSMUSG00000070733
AA Change: I2724T

DomainStartEndE-ValueType
Pfam:MOR2-PAG1_N 117 649 5.7e-176 PFAM
low complexity region 873 884 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 896 1141 1.3e-5 PFAM
Pfam:MOR2-PAG1_mid 1145 1331 2e-19 PFAM
Pfam:MOR2-PAG1_mid 1351 1450 1.2e-5 PFAM
low complexity region 1476 1487 N/A INTRINSIC
low complexity region 1530 1548 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 1590 1660 1.1e-5 PFAM
Pfam:MOR2-PAG1_mid 1725 1866 3.2e-15 PFAM
low complexity region 1973 1984 N/A INTRINSIC
Pfam:MOR2-PAG1_C 2002 2255 9.9e-78 PFAM
low complexity region 2329 2341 N/A INTRINSIC
low complexity region 2473 2482 N/A INTRINSIC
low complexity region 2485 2500 N/A INTRINSIC
low complexity region 2523 2534 N/A INTRINSIC
coiled coil region 2625 2649 N/A INTRINSIC
low complexity region 2827 2841 N/A INTRINSIC
coiled coil region 2854 2893 N/A INTRINSIC
coiled coil region 2963 2989 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101127
AA Change: I2724T

PolyPhen 2 Score 0.180 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000098687
Gene: ENSMUSG00000070733
AA Change: I2724T

DomainStartEndE-ValueType
Pfam:MOR2-PAG1_N 116 649 3e-172 PFAM
low complexity region 873 884 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 898 1115 7.8e-6 PFAM
Pfam:MOR2-PAG1_mid 1147 1331 9.5e-19 PFAM
Pfam:MOR2-PAG1_mid 1351 1503 1.1e-5 PFAM
low complexity region 1530 1548 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 1589 1664 6e-6 PFAM
Pfam:MOR2-PAG1_mid 1725 1866 1.6e-14 PFAM
low complexity region 1973 1984 N/A INTRINSIC
Pfam:MOR2-PAG1_C 1998 2260 4.4e-76 PFAM
low complexity region 2329 2341 N/A INTRINSIC
low complexity region 2473 2482 N/A INTRINSIC
low complexity region 2485 2500 N/A INTRINSIC
low complexity region 2523 2534 N/A INTRINSIC
coiled coil region 2625 2649 N/A INTRINSIC
low complexity region 2827 2841 N/A INTRINSIC
coiled coil region 2854 2893 N/A INTRINSIC
coiled coil region 2963 2989 N/A INTRINSIC
Predicted Effect
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Most mice homozygous for a knock-out allele exhibit postnatal lethality and defects in kidney development; rare survivors display growth retardation, decreased body weight, and premature death associated with chronic hydronephrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik A T 1: 26,685,270 N276K probably benign Het
9830107B12Rik T A 17: 48,145,579 Y63F possibly damaging Het
Abi1 A T 2: 22,946,584 I421N probably benign Het
Ahnak A G 19: 9,016,156 I4935V probably benign Het
Atg12 A C 18: 46,734,484 V131G probably damaging Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 CACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGT CACTGGTTCTGTGGTGACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGT 3: 95,888,138 probably benign Het
BC028528 TTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGG TTCTGTGGTCACTGGGTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGG 3: 95,888,144 probably benign Het
Bcl3 C T 7: 19,812,494 V139I probably damaging Het
Bloc1s4 T A 5: 36,748,345 M101L probably benign Het
Bmp6 C T 13: 38,346,257 Q109* probably null Het
Cabyr C T 18: 12,744,599 T28I possibly damaging Het
Catsper3 T C 13: 55,784,725 S22P probably benign Het
Catsperg2 A T 7: 29,712,981 C395S probably null Het
Cd101 T C 3: 101,018,792 T208A probably benign Het
Chaf1a A G 17: 56,064,148 S678G probably benign Het
Chrna2 A C 14: 66,151,035 I500L probably benign Het
Cln6 C T 9: 62,850,757 T266I possibly damaging Het
Col17a1 T A 19: 47,671,524 T330S possibly damaging Het
Cyp2d40 A G 15: 82,760,774 V225A unknown Het
Dnah10 A G 5: 124,799,031 N2645D probably damaging Het
Dph5 T A 3: 115,892,797 V74D probably benign Het
Dthd1 A T 5: 62,843,092 I586L probably damaging Het
Elane G A 10: 79,887,045 R95Q probably benign Het
Fbxw17 A G 13: 50,433,362 T453A probably damaging Het
Fpr3 C A 17: 17,970,965 T166K probably damaging Het
Fsip2 C T 2: 82,949,512 R201C probably damaging Het
Gm14496 T A 2: 181,991,257 F11Y possibly damaging Het
Gm14496 A G 2: 182,000,837 N767S probably damaging Het
Hyal4 T A 6: 24,765,934 M429K possibly damaging Het
Itgad A T 7: 128,183,015 T208S probably damaging Het
Itpr3 T G 17: 27,110,888 L1552R probably benign Het
Kcp C T 6: 29,499,187 C292Y probably damaging Het
Kdr T C 5: 75,948,843 K958R probably damaging Het
Klhl22 T A 16: 17,789,284 W485R probably damaging Het
Ldhb T A 6: 142,492,519 I271F possibly damaging Het
Lmo7 A G 14: 101,885,301 R309G probably damaging Het
Marco C A 1: 120,474,666 C517F probably damaging Het
Mpdz G A 4: 81,303,654 T1423I probably benign Het
Ncoa2 T C 1: 13,148,376 S1410G probably benign Het
Ncor1 T C 11: 62,401,265 N283S probably damaging Het
Nlrp14 T A 7: 107,181,887 L97* probably null Het
Olfm3 T G 3: 115,122,744 S442A probably damaging Het
Olfr116 T C 17: 37,624,501 I45V probably damaging Het
Olfr1436 T C 19: 12,298,848 T95A probably benign Het
Olfr693 T C 7: 106,678,126 Y120C probably damaging Het
Olfr76 T A 19: 12,120,011 S234C probably benign Het
Olfr796 A G 10: 129,608,160 V107A possibly damaging Het
Pank4 G A 4: 154,980,550 V769I probably benign Het
Pdgfrb G A 18: 61,083,264 D1065N probably damaging Het
Ppp1r12a G A 10: 108,268,640 S911N probably benign Het
Prdx6b A G 2: 80,292,990 T48A probably damaging Het
Pttg1ip A G 10: 77,597,036 K166E probably damaging Het
Rabgap1l T C 1: 160,251,417 D9G Het
Rpl13a C T 7: 45,127,042 G69S probably benign Het
Rps6ka5 T A 12: 100,616,083 I177F probably damaging Het
Rttn C A 18: 89,060,479 A1343E probably damaging Het
Ryr2 C T 13: 11,560,653 V4820I possibly damaging Het
Slc12a7 A G 13: 73,790,772 I223V possibly damaging Het
Slc9a3 G A 13: 74,157,694 V277M probably damaging Het
Spata13 A T 14: 60,751,849 Y988F probably damaging Het
Spo11 A G 2: 172,992,071 I329V possibly damaging Het
Tcp11l2 A T 10: 84,587,134 D63V probably damaging Het
Tdrd3 G A 14: 87,506,593 W659* probably null Het
Thnsl2 T C 6: 71,141,327 D39G probably benign Het
Thumpd1 A T 7: 119,716,862 L288* probably null Het
Tram1l1 T C 3: 124,321,907 Y239H probably damaging Het
Usp38 T A 8: 80,981,972 E992D probably damaging Het
Usp45 A G 4: 21,784,790 T159A probably benign Het
Vmn1r218 C T 13: 23,136,660 T59I probably benign Het
Vmn2r70 T C 7: 85,565,291 I218V probably benign Het
Xpr1 T C 1: 155,307,742 I461V probably benign Het
Ydjc T C 16: 17,147,005 L8P probably damaging Het
Yme1l1 A T 2: 23,160,220 N21I possibly damaging Het
Zfhx4 T C 3: 5,390,366 L1140P probably benign Het
Other mutations in Fryl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Fryl APN 5 73148108 missense possibly damaging 0.92
IGL01518:Fryl APN 5 73086962 missense possibly damaging 0.76
IGL01545:Fryl APN 5 73054597 missense probably damaging 1.00
IGL01646:Fryl APN 5 73022501 critical splice donor site probably null
IGL01938:Fryl APN 5 73122364 missense probably damaging 0.98
IGL01962:Fryl APN 5 73032791 missense possibly damaging 0.62
IGL02064:Fryl APN 5 73124769 unclassified probably benign
IGL02148:Fryl APN 5 73075959 missense probably benign 0.35
IGL02418:Fryl APN 5 73110176 splice site probably benign
IGL02431:Fryl APN 5 73098308 missense probably benign 0.02
IGL02513:Fryl APN 5 73065293 missense probably damaging 1.00
IGL02557:Fryl APN 5 73098393 missense probably damaging 1.00
IGL02625:Fryl APN 5 73069877 intron probably benign
IGL02642:Fryl APN 5 73095466 missense probably benign
IGL02657:Fryl APN 5 73054860 missense probably benign 0.01
IGL02706:Fryl APN 5 73093163 missense probably benign 0.45
IGL03022:Fryl APN 5 73059383 missense possibly damaging 0.82
IGL03144:Fryl APN 5 73101455 missense probably null 0.22
IGL03155:Fryl APN 5 73076695 missense probably benign
IGL03183:Fryl APN 5 73076695 missense probably benign
IGL03275:Fryl APN 5 73148033 missense possibly damaging 0.47
IGL03310:Fryl APN 5 73136316 splice site probably benign
IGL03341:Fryl APN 5 73076695 missense probably benign
IGL03343:Fryl APN 5 73076695 missense probably benign
IGL03350:Fryl APN 5 73133306 missense probably damaging 0.99
IGL03357:Fryl APN 5 73054059 missense probably damaging 1.00
IGL03374:Fryl APN 5 73110281 splice site probably benign
IGL03375:Fryl APN 5 73088449 missense possibly damaging 0.91
bedeviled UTSW 5 73059500 missense probably damaging 1.00
Besotted UTSW 5 73072912 missense probably damaging 1.00
R0062:Fryl UTSW 5 73022278 missense probably benign 0.02
R0062:Fryl UTSW 5 73022278 missense probably benign 0.02
R0308:Fryl UTSW 5 73041604 splice site probably benign
R0312:Fryl UTSW 5 73072888 missense probably damaging 1.00
R0415:Fryl UTSW 5 73098414 missense probably damaging 0.99
R0440:Fryl UTSW 5 73086972 missense possibly damaging 0.91
R0446:Fryl UTSW 5 73097417 missense possibly damaging 0.91
R0566:Fryl UTSW 5 73064497 splice site probably benign
R0567:Fryl UTSW 5 73065391 missense possibly damaging 0.50
R0606:Fryl UTSW 5 73124734 missense probably benign 0.15
R0619:Fryl UTSW 5 73068731 missense probably benign 0.22
R0654:Fryl UTSW 5 73083372 missense probably benign 0.17
R0658:Fryl UTSW 5 73065359 missense probably damaging 1.00
R0707:Fryl UTSW 5 73083372 missense probably benign 0.17
R0744:Fryl UTSW 5 73089081 unclassified probably benign
R0745:Fryl UTSW 5 73071126 missense probably damaging 0.96
R0833:Fryl UTSW 5 73089081 unclassified probably benign
R0885:Fryl UTSW 5 73089196 missense probably damaging 0.97
R0894:Fryl UTSW 5 73041332 splice site probably benign
R1076:Fryl UTSW 5 73124673 unclassified probably benign
R1241:Fryl UTSW 5 73064925 splice site probably benign
R1241:Fryl UTSW 5 73110271 missense probably damaging 1.00
R1394:Fryl UTSW 5 73072912 missense probably damaging 1.00
R1395:Fryl UTSW 5 73072912 missense probably damaging 1.00
R1608:Fryl UTSW 5 73074751 nonsense probably null
R1664:Fryl UTSW 5 73059435 missense probably damaging 1.00
R1745:Fryl UTSW 5 73032861 splice site probably benign
R1937:Fryl UTSW 5 73133367 missense probably damaging 1.00
R1969:Fryl UTSW 5 73098266 missense probably benign 0.18
R1993:Fryl UTSW 5 73108493 missense probably damaging 1.00
R1994:Fryl UTSW 5 73108493 missense probably damaging 1.00
R2029:Fryl UTSW 5 73022122 nonsense probably null
R2036:Fryl UTSW 5 73022544 missense probably benign
R2036:Fryl UTSW 5 73107962 critical splice donor site probably null
R2088:Fryl UTSW 5 73065461 missense probably benign 0.02
R2105:Fryl UTSW 5 73122299 missense probably benign
R2106:Fryl UTSW 5 73098331 missense probably damaging 1.00
R2186:Fryl UTSW 5 73064975 missense probably damaging 1.00
R2239:Fryl UTSW 5 73108547 missense probably damaging 0.99
R2256:Fryl UTSW 5 73072844 missense possibly damaging 0.47
R2257:Fryl UTSW 5 73072844 missense possibly damaging 0.47
R2280:Fryl UTSW 5 73041364 missense possibly damaging 0.47
R2281:Fryl UTSW 5 73041364 missense possibly damaging 0.47
R2911:Fryl UTSW 5 73050456 missense probably damaging 0.99
R3019:Fryl UTSW 5 73082850 missense probably benign 0.01
R3416:Fryl UTSW 5 73108074 missense possibly damaging 0.84
R3783:Fryl UTSW 5 73101476 missense probably benign
R3787:Fryl UTSW 5 73101476 missense probably benign
R3837:Fryl UTSW 5 73071265 missense probably benign 0.03
R3969:Fryl UTSW 5 73112423 missense probably damaging 0.97
R4387:Fryl UTSW 5 73086560 missense possibly damaging 0.91
R4502:Fryl UTSW 5 73088397 missense probably damaging 1.00
R4658:Fryl UTSW 5 73081053 missense probably damaging 1.00
R4664:Fryl UTSW 5 73090679 missense possibly damaging 0.80
R4690:Fryl UTSW 5 73100293 missense probably benign
R4700:Fryl UTSW 5 73065538 missense possibly damaging 0.88
R4709:Fryl UTSW 5 73080972 missense probably benign 0.03
R4807:Fryl UTSW 5 73041362 missense probably benign 0.00
R4912:Fryl UTSW 5 73068782 frame shift probably null
R4948:Fryl UTSW 5 73089130 missense probably benign 0.08
R4959:Fryl UTSW 5 73035058 missense probably benign 0.00
R5062:Fryl UTSW 5 73075893 missense possibly damaging 0.89
R5067:Fryl UTSW 5 73057755 missense probably benign 0.13
R5071:Fryl UTSW 5 73074767 missense probably damaging 0.99
R5072:Fryl UTSW 5 73074767 missense probably damaging 0.99
R5073:Fryl UTSW 5 73074767 missense probably damaging 0.99
R5074:Fryl UTSW 5 73074767 missense probably damaging 0.99
R5139:Fryl UTSW 5 73090718 missense probably damaging 1.00
R5172:Fryl UTSW 5 73101673 missense possibly damaging 0.95
R5187:Fryl UTSW 5 73086600 missense possibly damaging 0.95
R5272:Fryl UTSW 5 73065136 nonsense probably null
R5275:Fryl UTSW 5 73112791 missense probably damaging 1.00
R5295:Fryl UTSW 5 73112791 missense probably damaging 1.00
R5344:Fryl UTSW 5 73104774 missense probably damaging 1.00
R5355:Fryl UTSW 5 73073904 missense probably damaging 1.00
R5716:Fryl UTSW 5 73100465 missense probably benign
R5778:Fryl UTSW 5 73072778 missense probably damaging 1.00
R5810:Fryl UTSW 5 73090755 missense probably benign 0.06
R5934:Fryl UTSW 5 73090717 missense probably damaging 1.00
R5948:Fryl UTSW 5 73097372 critical splice donor site probably null
R6005:Fryl UTSW 5 73083295 missense probably damaging 1.00
R6026:Fryl UTSW 5 73099997 missense probably benign 0.04
R6045:Fryl UTSW 5 73118551 missense probably damaging 0.99
R6185:Fryl UTSW 5 73112788 missense probably benign 0.43
R6247:Fryl UTSW 5 73065481 missense probably damaging 0.98
R6294:Fryl UTSW 5 73191759 intron probably benign
R6310:Fryl UTSW 5 73191761 intron probably benign
R6429:Fryl UTSW 5 73090751 missense possibly damaging 0.84
R6568:Fryl UTSW 5 73059516 missense probably damaging 1.00
R6636:Fryl UTSW 5 73133312 missense probably benign 0.01
R6664:Fryl UTSW 5 73132481 missense probably damaging 1.00
R6732:Fryl UTSW 5 73054781 missense probably damaging 1.00
R6750:Fryl UTSW 5 73022232 missense probably damaging 1.00
R6805:Fryl UTSW 5 73065094 missense probably benign 0.03
R6823:Fryl UTSW 5 73065217 missense probably damaging 0.99
R6855:Fryl UTSW 5 73059500 missense probably damaging 1.00
R6858:Fryl UTSW 5 73065032 missense probably damaging 1.00
R6868:Fryl UTSW 5 73068803 missense probably damaging 1.00
R6898:Fryl UTSW 5 73022142 missense probably damaging 0.96
R6908:Fryl UTSW 5 73022211 missense probably damaging 1.00
R6958:Fryl UTSW 5 73073929 missense possibly damaging 0.89
R6980:Fryl UTSW 5 73050430 missense probably benign 0.06
R7036:Fryl UTSW 5 73055608 missense probably benign 0.03
R7065:Fryl UTSW 5 73090756 missense probably damaging 0.96
R7097:Fryl UTSW 5 73073908 missense probably benign 0.31
R7171:Fryl UTSW 5 73122310 missense probably damaging 0.97
R7191:Fryl UTSW 5 73072912 missense probably damaging 1.00
R7207:Fryl UTSW 5 73065095 missense probably benign
R7236:Fryl UTSW 5 73108478 missense possibly damaging 0.66
R7334:Fryl UTSW 5 73047496 splice site probably null
R7425:Fryl UTSW 5 73104748 missense probably damaging 1.00
R7452:Fryl UTSW 5 73023988 missense probably damaging 1.00
R7479:Fryl UTSW 5 73097561 missense possibly damaging 0.71
R7535:Fryl UTSW 5 73098196 missense probably benign 0.15
R7538:Fryl UTSW 5 73022676 missense probably benign 0.09
R7544:Fryl UTSW 5 73081039 missense probably benign
R7548:Fryl UTSW 5 73191762 missense unknown
R7572:Fryl UTSW 5 73088396 missense possibly damaging 0.91
R7582:Fryl UTSW 5 73022500 critical splice donor site probably null
R7630:Fryl UTSW 5 73110245 missense possibly damaging 0.62
R7774:Fryl UTSW 5 73083384 missense probably benign 0.12
R7777:Fryl UTSW 5 73071298 missense probably damaging 0.98
R7917:Fryl UTSW 5 73054532 missense probably damaging 1.00
R7920:Fryl UTSW 5 73101807 splice site probably null
R8110:Fryl UTSW 5 73133277 missense probably benign 0.10
R8120:Fryl UTSW 5 73071184 missense probably benign 0.01
R8143:Fryl UTSW 5 73050339 missense probably benign 0.00
R8207:Fryl UTSW 5 73100500 splice site probably null
R8263:Fryl UTSW 5 73081005 missense probably damaging 1.00
R8350:Fryl UTSW 5 73068730 missense probably benign
R8359:Fryl UTSW 5 73075933 missense probably benign 0.39
R8387:Fryl UTSW 5 73136320 critical splice donor site probably null
R8403:Fryl UTSW 5 73118447 makesense probably null
R8450:Fryl UTSW 5 73068730 missense probably benign
R8514:Fryl UTSW 5 73085356 missense probably benign
R8536:Fryl UTSW 5 73100353 missense probably damaging 0.99
R8703:Fryl UTSW 5 73090654 missense not run
R8708:Fryl UTSW 5 73132562 missense not run
R8783:Fryl UTSW 5 73068842 missense not run
Z1088:Fryl UTSW 5 73090709 missense probably damaging 0.99
Z1088:Fryl UTSW 5 73090738 missense probably damaging 1.00
Z1176:Fryl UTSW 5 73072837 missense probably benign
Z1177:Fryl UTSW 5 73041595 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AACATCATTCCAGTGTAGTCCCC -3'
(R):5'- GCTCCTAAAGAAATATGTACAGGC -3'

Sequencing Primer
(F):5'- GGCTGGCTTGGAACTCATTATACAC -3'
(R):5'- TATGTACAGGCCTAACAGATCTGC -3'
Posted On2019-10-17