Incidental Mutation 'R7565:Catsperg2'
ID585378
Institutional Source Beutler Lab
Gene Symbol Catsperg2
Ensembl Gene ENSMUSG00000049123
Gene Namecation channel sperm associated auxiliary subunit gamma 2
Synonyms1700067C01Rik, CATSPERG
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R7565 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location29697219-29727032 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 29712981 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 395 (C395S)
Ref Sequence ENSEMBL: ENSMUSP00000147099 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061193] [ENSMUST00000207115] [ENSMUST00000208371] [ENSMUST00000208607] [ENSMUST00000209126]
Predicted Effect probably null
Transcript: ENSMUST00000061193
AA Change: C395S

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000052285
Gene: ENSMUSG00000049123
AA Change: C395S

DomainStartEndE-ValueType
Pfam:CATSPERG 2 973 N/A PFAM
transmembrane domain 1065 1087 N/A INTRINSIC
low complexity region 1106 1118 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000207115
AA Change: C275S

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect probably benign
Transcript: ENSMUST00000208371
Predicted Effect possibly damaging
Transcript: ENSMUST00000208607
AA Change: C395S

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect probably null
Transcript: ENSMUST00000209126
AA Change: C395S

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik A T 1: 26,685,270 N276K probably benign Het
9830107B12Rik T A 17: 48,145,579 Y63F possibly damaging Het
Abi1 A T 2: 22,946,584 I421N probably benign Het
Ahnak A G 19: 9,016,156 I4935V probably benign Het
Atg12 A C 18: 46,734,484 V131G probably damaging Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 CACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGT CACTGGTTCTGTGGTGACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGT 3: 95,888,138 probably benign Het
BC028528 TTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGG TTCTGTGGTCACTGGGTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGG 3: 95,888,144 probably benign Het
Bcl3 C T 7: 19,812,494 V139I probably damaging Het
Bloc1s4 T A 5: 36,748,345 M101L probably benign Het
Bmp6 C T 13: 38,346,257 Q109* probably null Het
Cabyr C T 18: 12,744,599 T28I possibly damaging Het
Catsper3 T C 13: 55,784,725 S22P probably benign Het
Cd101 T C 3: 101,018,792 T208A probably benign Het
Chaf1a A G 17: 56,064,148 S678G probably benign Het
Chrna2 A C 14: 66,151,035 I500L probably benign Het
Cln6 C T 9: 62,850,757 T266I possibly damaging Het
Col17a1 T A 19: 47,671,524 T330S possibly damaging Het
Cyp2d40 A G 15: 82,760,774 V225A unknown Het
Dnah10 A G 5: 124,799,031 N2645D probably damaging Het
Dph5 T A 3: 115,892,797 V74D probably benign Het
Dthd1 A T 5: 62,843,092 I586L probably damaging Het
Elane G A 10: 79,887,045 R95Q probably benign Het
Fbxw17 A G 13: 50,433,362 T453A probably damaging Het
Fpr3 C A 17: 17,970,965 T166K probably damaging Het
Fryl A G 5: 73,033,720 I2724T probably benign Het
Fsip2 C T 2: 82,949,512 R201C probably damaging Het
Gm14496 T A 2: 181,991,257 F11Y possibly damaging Het
Gm14496 A G 2: 182,000,837 N767S probably damaging Het
Hyal4 T A 6: 24,765,934 M429K possibly damaging Het
Itgad A T 7: 128,183,015 T208S probably damaging Het
Itpr3 T G 17: 27,110,888 L1552R probably benign Het
Kcp C T 6: 29,499,187 C292Y probably damaging Het
Kdr T C 5: 75,948,843 K958R probably damaging Het
Klhl22 T A 16: 17,789,284 W485R probably damaging Het
Ldhb T A 6: 142,492,519 I271F possibly damaging Het
Lmo7 A G 14: 101,885,301 R309G probably damaging Het
Marco C A 1: 120,474,666 C517F probably damaging Het
Mpdz G A 4: 81,303,654 T1423I probably benign Het
Ncoa2 T C 1: 13,148,376 S1410G probably benign Het
Ncor1 T C 11: 62,401,265 N283S probably damaging Het
Nlrp14 T A 7: 107,181,887 L97* probably null Het
Olfm3 T G 3: 115,122,744 S442A probably damaging Het
Olfr116 T C 17: 37,624,501 I45V probably damaging Het
Olfr1436 T C 19: 12,298,848 T95A probably benign Het
Olfr693 T C 7: 106,678,126 Y120C probably damaging Het
Olfr76 T A 19: 12,120,011 S234C probably benign Het
Olfr796 A G 10: 129,608,160 V107A possibly damaging Het
Pank4 G A 4: 154,980,550 V769I probably benign Het
Pdgfrb G A 18: 61,083,264 D1065N probably damaging Het
Ppp1r12a G A 10: 108,268,640 S911N probably benign Het
Prdx6b A G 2: 80,292,990 T48A probably damaging Het
Pttg1ip A G 10: 77,597,036 K166E probably damaging Het
Rabgap1l T C 1: 160,251,417 D9G Het
Rpl13a C T 7: 45,127,042 G69S probably benign Het
Rps6ka5 T A 12: 100,616,083 I177F probably damaging Het
Rttn C A 18: 89,060,479 A1343E probably damaging Het
Ryr2 C T 13: 11,560,653 V4820I possibly damaging Het
Slc12a7 A G 13: 73,790,772 I223V possibly damaging Het
Slc9a3 G A 13: 74,157,694 V277M probably damaging Het
Spata13 A T 14: 60,751,849 Y988F probably damaging Het
Spo11 A G 2: 172,992,071 I329V possibly damaging Het
Tcp11l2 A T 10: 84,587,134 D63V probably damaging Het
Tdrd3 G A 14: 87,506,593 W659* probably null Het
Thnsl2 T C 6: 71,141,327 D39G probably benign Het
Thumpd1 A T 7: 119,716,862 L288* probably null Het
Tram1l1 T C 3: 124,321,907 Y239H probably damaging Het
Usp38 T A 8: 80,981,972 E992D probably damaging Het
Usp45 A G 4: 21,784,790 T159A probably benign Het
Vmn1r218 C T 13: 23,136,660 T59I probably benign Het
Vmn2r70 T C 7: 85,565,291 I218V probably benign Het
Xpr1 T C 1: 155,307,742 I461V probably benign Het
Ydjc T C 16: 17,147,005 L8P probably damaging Het
Yme1l1 A T 2: 23,160,220 N21I possibly damaging Het
Zfhx4 T C 3: 5,390,366 L1140P probably benign Het
Other mutations in Catsperg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Catsperg2 APN 7 29705404 missense possibly damaging 0.86
IGL00095:Catsperg2 APN 7 29698058 missense possibly damaging 0.73
IGL00902:Catsperg2 APN 7 29701143 missense possibly damaging 0.93
IGL01667:Catsperg2 APN 7 29710133 missense probably damaging 0.98
IGL01791:Catsperg2 APN 7 29704665 splice site probably null
IGL01961:Catsperg2 APN 7 29721672 splice site probably benign
IGL02187:Catsperg2 APN 7 29721366 missense probably benign 0.02
IGL02605:Catsperg2 APN 7 29719565 missense possibly damaging 0.71
IGL03001:Catsperg2 APN 7 29725079 missense probably benign 0.32
IGL03228:Catsperg2 APN 7 29698225 missense probably damaging 0.96
IGL03239:Catsperg2 APN 7 29697716 missense probably benign 0.04
IGL03242:Catsperg2 APN 7 29725479 unclassified probably benign
IGL03247:Catsperg2 APN 7 29717048 missense possibly damaging 0.71
IGL03256:Catsperg2 APN 7 29709874 missense probably damaging 0.99
PIT4520001:Catsperg2 UTSW 7 29710161 missense possibly damaging 0.93
R0052:Catsperg2 UTSW 7 29725020 splice site probably benign
R0281:Catsperg2 UTSW 7 29706571 missense possibly damaging 0.86
R0357:Catsperg2 UTSW 7 29714901 missense possibly damaging 0.93
R0480:Catsperg2 UTSW 7 29721298 missense probably damaging 0.98
R0578:Catsperg2 UTSW 7 29704691 missense possibly damaging 0.71
R0732:Catsperg2 UTSW 7 29700696 missense probably damaging 1.00
R0826:Catsperg2 UTSW 7 29705624 missense possibly damaging 0.92
R1535:Catsperg2 UTSW 7 29698246 missense possibly damaging 0.85
R1925:Catsperg2 UTSW 7 29697764 missense probably benign 0.01
R1990:Catsperg2 UTSW 7 29721045 nonsense probably null
R3433:Catsperg2 UTSW 7 29701218 missense possibly damaging 0.71
R3721:Catsperg2 UTSW 7 29705102 missense probably benign 0.02
R4020:Catsperg2 UTSW 7 29717004 missense probably damaging 0.99
R4760:Catsperg2 UTSW 7 29705635 missense probably damaging 0.99
R4829:Catsperg2 UTSW 7 29701125 missense probably damaging 0.98
R5033:Catsperg2 UTSW 7 29710134 missense possibly damaging 0.93
R5093:Catsperg2 UTSW 7 29716998 missense probably benign 0.32
R5266:Catsperg2 UTSW 7 29717066 missense probably damaging 0.98
R5267:Catsperg2 UTSW 7 29717066 missense probably damaging 0.98
R5287:Catsperg2 UTSW 7 29697838 missense possibly damaging 0.96
R5427:Catsperg2 UTSW 7 29714850 missense possibly damaging 0.71
R5575:Catsperg2 UTSW 7 29705590 missense possibly damaging 0.84
R5685:Catsperg2 UTSW 7 29701188 missense probably damaging 1.00
R5844:Catsperg2 UTSW 7 29697832 missense possibly damaging 0.96
R5982:Catsperg2 UTSW 7 29713017 missense possibly damaging 0.51
R6662:Catsperg2 UTSW 7 29719513 start gained probably benign
R6744:Catsperg2 UTSW 7 29709819 missense probably benign 0.23
R7171:Catsperg2 UTSW 7 29705325 missense possibly damaging 0.71
R7239:Catsperg2 UTSW 7 29710082 missense probably benign 0.00
R7336:Catsperg2 UTSW 7 29706601 missense possibly damaging 0.83
R7498:Catsperg2 UTSW 7 29717102 missense possibly damaging 0.71
R7548:Catsperg2 UTSW 7 29709826 missense probably benign 0.32
R7562:Catsperg2 UTSW 7 29697719 missense probably benign 0.18
R7600:Catsperg2 UTSW 7 29704858 missense probably benign 0.32
Z1177:Catsperg2 UTSW 7 29697782 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- TATGTAGCCCAGTCGATGCTG -3'
(R):5'- CTGGCCTGTATTGGTCACAC -3'

Sequencing Primer
(F):5'- AGTCGATGCTGCAGTTTTTACC -3'
(R):5'- GGAGTCAGCCTGAACCCTAG -3'
Posted On2019-10-17