Incidental Mutation 'R7565:Rpl13a'
ID585379
Institutional Source Beutler Lab
Gene Symbol Rpl13a
Ensembl Gene ENSMUSG00000074129
Gene Nameribosomal protein L13A
SynonymsTstap198-7, tum-transplantation antigen P198, tum-antigen, 1810026N22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.950) question?
Stock #R7565 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location45125558-45128761 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 45127042 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 69 (G69S)
Ref Sequence ENSEMBL: ENSMUSP00000115722 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003521] [ENSMUST00000146760] [ENSMUST00000150350] [ENSMUST00000209212] [ENSMUST00000209238] [ENSMUST00000209467] [ENSMUST00000209711] [ENSMUST00000209812] [ENSMUST00000209815] [ENSMUST00000209927] [ENSMUST00000210191] [ENSMUST00000210818] [ENSMUST00000210918] [ENSMUST00000210931] [ENSMUST00000210967] [ENSMUST00000211037] [ENSMUST00000211429] [ENSMUST00000211725]
Predicted Effect probably benign
Transcript: ENSMUST00000003521
SMART Domains Protein: ENSMUSP00000003521
Gene: ENSMUSG00000003429

DomainStartEndE-ValueType
Pfam:Ribosomal_S17_N 5 73 1.9e-40 PFAM
Pfam:Ribosomal_S17 75 144 1.4e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146760
SMART Domains Protein: ENSMUSP00000123506
Gene: ENSMUSG00000110206

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Flt3_lig 28 162 1.9e-94 PFAM
transmembrane domain 189 211 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150350
AA Change: G69S

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000115722
Gene: ENSMUSG00000074129
AA Change: G69S

DomainStartEndE-ValueType
Pfam:Ribosomal_L13 6 122 7e-27 PFAM
low complexity region 169 180 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000209212
AA Change: G65S

PolyPhen 2 Score 0.843 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000209238
Predicted Effect possibly damaging
Transcript: ENSMUST00000209467
AA Change: G312S

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000209711
Predicted Effect possibly damaging
Transcript: ENSMUST00000209812
AA Change: R67K

PolyPhen 2 Score 0.617 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000209815
AA Change: G65S

PolyPhen 2 Score 0.890 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000209838
Predicted Effect possibly damaging
Transcript: ENSMUST00000209927
AA Change: G43S

PolyPhen 2 Score 0.647 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000210191
AA Change: G69S

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000210818
Predicted Effect probably benign
Transcript: ENSMUST00000210918
AA Change: G69S

PolyPhen 2 Score 0.226 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000210931
Predicted Effect probably damaging
Transcript: ENSMUST00000210967
AA Change: G69S

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000211037
AA Change: G65S

PolyPhen 2 Score 0.353 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000211429
Predicted Effect probably benign
Transcript: ENSMUST00000211725
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a member of the L13P family of ribosomal proteins that is a component of the 60S subunit. The encoded protein also plays a role in the repression of inflammatory genes as a component of the IFN-gamma-activated inhibitor of translation (GAIT) complex. This gene is co-transcribed with the small nucleolar RNA genes U32, U33, U34, and U35, which are located in the second, fourth, fifth, and sixth introns, respectively. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed throughout the genome. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygotes lacking snoRNAs encoded by introns of this gene show altered mitochondrial metabolism, lower reactive oxygen species tone, enhanced glucose-stimulated insulin secretion and glucose tolerance, reduced oxidative stress responses in pancreatic islets, and resistance to diabetogenic stimuli. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik A T 1: 26,685,270 N276K probably benign Het
9830107B12Rik T A 17: 48,145,579 Y63F possibly damaging Het
Abi1 A T 2: 22,946,584 I421N probably benign Het
Ahnak A G 19: 9,016,156 I4935V probably benign Het
Atg12 A C 18: 46,734,484 V131G probably damaging Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 CACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGT CACTGGTTCTGTGGTGACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGT 3: 95,888,138 probably benign Het
BC028528 TTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGG TTCTGTGGTCACTGGGTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGG 3: 95,888,144 probably benign Het
Bcl3 C T 7: 19,812,494 V139I probably damaging Het
Bloc1s4 T A 5: 36,748,345 M101L probably benign Het
Bmp6 C T 13: 38,346,257 Q109* probably null Het
Cabyr C T 18: 12,744,599 T28I possibly damaging Het
Catsper3 T C 13: 55,784,725 S22P probably benign Het
Catsperg2 A T 7: 29,712,981 C395S probably null Het
Cd101 T C 3: 101,018,792 T208A probably benign Het
Chaf1a A G 17: 56,064,148 S678G probably benign Het
Chrna2 A C 14: 66,151,035 I500L probably benign Het
Cln6 C T 9: 62,850,757 T266I possibly damaging Het
Col17a1 T A 19: 47,671,524 T330S possibly damaging Het
Cyp2d40 A G 15: 82,760,774 V225A unknown Het
Dnah10 A G 5: 124,799,031 N2645D probably damaging Het
Dph5 T A 3: 115,892,797 V74D probably benign Het
Dthd1 A T 5: 62,843,092 I586L probably damaging Het
Elane G A 10: 79,887,045 R95Q probably benign Het
Fbxw17 A G 13: 50,433,362 T453A probably damaging Het
Fpr3 C A 17: 17,970,965 T166K probably damaging Het
Fryl A G 5: 73,033,720 I2724T probably benign Het
Fsip2 C T 2: 82,949,512 R201C probably damaging Het
Gm14496 T A 2: 181,991,257 F11Y possibly damaging Het
Gm14496 A G 2: 182,000,837 N767S probably damaging Het
Hyal4 T A 6: 24,765,934 M429K possibly damaging Het
Itgad A T 7: 128,183,015 T208S probably damaging Het
Itpr3 T G 17: 27,110,888 L1552R probably benign Het
Kcp C T 6: 29,499,187 C292Y probably damaging Het
Kdr T C 5: 75,948,843 K958R probably damaging Het
Klhl22 T A 16: 17,789,284 W485R probably damaging Het
Ldhb T A 6: 142,492,519 I271F possibly damaging Het
Lmo7 A G 14: 101,885,301 R309G probably damaging Het
Marco C A 1: 120,474,666 C517F probably damaging Het
Mpdz G A 4: 81,303,654 T1423I probably benign Het
Ncoa2 T C 1: 13,148,376 S1410G probably benign Het
Ncor1 T C 11: 62,401,265 N283S probably damaging Het
Nlrp14 T A 7: 107,181,887 L97* probably null Het
Olfm3 T G 3: 115,122,744 S442A probably damaging Het
Olfr116 T C 17: 37,624,501 I45V probably damaging Het
Olfr1436 T C 19: 12,298,848 T95A probably benign Het
Olfr693 T C 7: 106,678,126 Y120C probably damaging Het
Olfr76 T A 19: 12,120,011 S234C probably benign Het
Olfr796 A G 10: 129,608,160 V107A possibly damaging Het
Pank4 G A 4: 154,980,550 V769I probably benign Het
Pdgfrb G A 18: 61,083,264 D1065N probably damaging Het
Ppp1r12a G A 10: 108,268,640 S911N probably benign Het
Prdx6b A G 2: 80,292,990 T48A probably damaging Het
Pttg1ip A G 10: 77,597,036 K166E probably damaging Het
Rabgap1l T C 1: 160,251,417 D9G Het
Rps6ka5 T A 12: 100,616,083 I177F probably damaging Het
Rttn C A 18: 89,060,479 A1343E probably damaging Het
Ryr2 C T 13: 11,560,653 V4820I possibly damaging Het
Slc12a7 A G 13: 73,790,772 I223V possibly damaging Het
Slc9a3 G A 13: 74,157,694 V277M probably damaging Het
Spata13 A T 14: 60,751,849 Y988F probably damaging Het
Spo11 A G 2: 172,992,071 I329V possibly damaging Het
Tcp11l2 A T 10: 84,587,134 D63V probably damaging Het
Tdrd3 G A 14: 87,506,593 W659* probably null Het
Thnsl2 T C 6: 71,141,327 D39G probably benign Het
Thumpd1 A T 7: 119,716,862 L288* probably null Het
Tram1l1 T C 3: 124,321,907 Y239H probably damaging Het
Usp38 T A 8: 80,981,972 E992D probably damaging Het
Usp45 A G 4: 21,784,790 T159A probably benign Het
Vmn1r218 C T 13: 23,136,660 T59I probably benign Het
Vmn2r70 T C 7: 85,565,291 I218V probably benign Het
Xpr1 T C 1: 155,307,742 I461V probably benign Het
Ydjc T C 16: 17,147,005 L8P probably damaging Het
Yme1l1 A T 2: 23,160,220 N21I possibly damaging Het
Zfhx4 T C 3: 5,390,366 L1140P probably benign Het
Other mutations in Rpl13a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Rpl13a APN 7 45127071 splice site probably null
R1972:Rpl13a UTSW 7 45125995 nonsense probably null
R1973:Rpl13a UTSW 7 45125995 nonsense probably null
R4501:Rpl13a UTSW 7 45126140 missense probably benign 0.13
R4674:Rpl13a UTSW 7 45126818 unclassified probably benign
R4675:Rpl13a UTSW 7 45126818 unclassified probably benign
R5151:Rpl13a UTSW 7 45125961 missense probably benign 0.35
R7667:Rpl13a UTSW 7 45126173 missense probably damaging 0.96
R7699:Rpl13a UTSW 7 45127236 missense probably benign 0.12
R7700:Rpl13a UTSW 7 45127236 missense probably benign 0.12
R8492:Rpl13a UTSW 7 45126521 missense possibly damaging 0.75
Z1088:Rpl13a UTSW 7 45127513 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTCAGATGGTAGTGCATGTAG -3'
(R):5'- CTGTTAACTCTAGGCCGGAAG -3'

Sequencing Primer
(F):5'- GTAGAGTCATCTCATAGTCGAGC -3'
(R):5'- CGCTGTGAAGGCATCAACATTTC -3'
Posted On2019-10-17