Incidental Mutation 'R7565:Ncor1'
ID585392
Institutional Source Beutler Lab
Gene Symbol Ncor1
Ensembl Gene ENSMUSG00000018501
Gene Namenuclear receptor co-repressor 1
Synonyms5730405M06Rik, A230020K14Rik, Rxrip13, N-CoR
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7565 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location62316426-62458541 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 62401265 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 283 (N283S)
Ref Sequence ENSEMBL: ENSMUSP00000018645 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018645] [ENSMUST00000069456] [ENSMUST00000101066] [ENSMUST00000101067] [ENSMUST00000127471] [ENSMUST00000155486]
Predicted Effect probably damaging
Transcript: ENSMUST00000018645
AA Change: N283S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000018645
Gene: ENSMUSG00000018501
AA Change: N283S

DomainStartEndE-ValueType
low complexity region 51 74 N/A INTRINSIC
Pfam:GPS2_interact 150 239 1.4e-37 PFAM
coiled coil region 302 329 N/A INTRINSIC
low complexity region 349 366 N/A INTRINSIC
SANT 437 485 2.76e-7 SMART
coiled coil region 507 544 N/A INTRINSIC
low complexity region 593 617 N/A INTRINSIC
SANT 624 672 3.29e-14 SMART
low complexity region 710 731 N/A INTRINSIC
low complexity region 771 788 N/A INTRINSIC
low complexity region 888 899 N/A INTRINSIC
low complexity region 987 995 N/A INTRINSIC
low complexity region 1002 1013 N/A INTRINSIC
low complexity region 1036 1049 N/A INTRINSIC
internal_repeat_2 1061 1298 1.62e-6 PROSPERO
internal_repeat_2 1299 1515 1.62e-6 PROSPERO
low complexity region 1516 1527 N/A INTRINSIC
coiled coil region 1712 1749 N/A INTRINSIC
low complexity region 1834 1848 N/A INTRINSIC
low complexity region 1969 1980 N/A INTRINSIC
low complexity region 2036 2055 N/A INTRINSIC
PDB:3N00|B 2064 2084 4e-7 PDB
low complexity region 2086 2101 N/A INTRINSIC
low complexity region 2157 2168 N/A INTRINSIC
PDB:2OVM|B 2267 2290 2e-8 PDB
low complexity region 2311 2324 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000069456
SMART Domains Protein: ENSMUSP00000068974
Gene: ENSMUSG00000018501

DomainStartEndE-ValueType
low complexity region 51 74 N/A INTRINSIC
coiled coil region 176 217 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000101066
AA Change: N283S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000098627
Gene: ENSMUSG00000018501
AA Change: N283S

DomainStartEndE-ValueType
low complexity region 51 74 N/A INTRINSIC
coiled coil region 176 217 N/A INTRINSIC
coiled coil region 302 329 N/A INTRINSIC
low complexity region 349 366 N/A INTRINSIC
SANT 437 485 2.76e-7 SMART
coiled coil region 507 544 N/A INTRINSIC
low complexity region 593 617 N/A INTRINSIC
SANT 624 672 3.29e-14 SMART
low complexity region 710 731 N/A INTRINSIC
low complexity region 771 788 N/A INTRINSIC
low complexity region 888 899 N/A INTRINSIC
low complexity region 987 995 N/A INTRINSIC
low complexity region 1002 1013 N/A INTRINSIC
low complexity region 1036 1049 N/A INTRINSIC
internal_repeat_2 1061 1298 1.62e-6 PROSPERO
internal_repeat_2 1299 1515 1.62e-6 PROSPERO
low complexity region 1516 1527 N/A INTRINSIC
coiled coil region 1712 1749 N/A INTRINSIC
low complexity region 1834 1848 N/A INTRINSIC
low complexity region 1969 1980 N/A INTRINSIC
low complexity region 2036 2055 N/A INTRINSIC
PDB:3N00|B 2064 2084 4e-7 PDB
low complexity region 2086 2101 N/A INTRINSIC
low complexity region 2157 2168 N/A INTRINSIC
PDB:2OVM|B 2267 2290 2e-8 PDB
low complexity region 2311 2324 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000101067
AA Change: N283S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000098628
Gene: ENSMUSG00000018501
AA Change: N283S

DomainStartEndE-ValueType
low complexity region 51 74 N/A INTRINSIC
coiled coil region 176 217 N/A INTRINSIC
coiled coil region 302 329 N/A INTRINSIC
low complexity region 349 366 N/A INTRINSIC
SANT 437 485 2.76e-7 SMART
coiled coil region 507 544 N/A INTRINSIC
low complexity region 593 617 N/A INTRINSIC
SANT 624 672 3.29e-14 SMART
low complexity region 716 734 N/A INTRINSIC
low complexity region 838 849 N/A INTRINSIC
low complexity region 937 945 N/A INTRINSIC
low complexity region 952 963 N/A INTRINSIC
low complexity region 986 999 N/A INTRINSIC
low complexity region 1448 1459 N/A INTRINSIC
coiled coil region 1645 1682 N/A INTRINSIC
low complexity region 1767 1781 N/A INTRINSIC
low complexity region 1902 1913 N/A INTRINSIC
low complexity region 1969 1988 N/A INTRINSIC
PDB:3N00|B 1997 2017 4e-7 PDB
low complexity region 2019 2034 N/A INTRINSIC
low complexity region 2089 2100 N/A INTRINSIC
PDB:2OVM|B 2199 2222 2e-8 PDB
low complexity region 2243 2256 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000127471
AA Change: N283S

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000121806
Gene: ENSMUSG00000018501
AA Change: N283S

DomainStartEndE-ValueType
low complexity region 51 74 N/A INTRINSIC
coiled coil region 176 217 N/A INTRINSIC
coiled coil region 302 329 N/A INTRINSIC
low complexity region 349 366 N/A INTRINSIC
SANT 437 485 2.76e-7 SMART
coiled coil region 508 545 N/A INTRINSIC
low complexity region 594 618 N/A INTRINSIC
SANT 625 673 3.29e-14 SMART
low complexity region 711 732 N/A INTRINSIC
low complexity region 756 773 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000155486
AA Change: N292S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000122647
Gene: ENSMUSG00000018501
AA Change: N292S

DomainStartEndE-ValueType
low complexity region 51 74 N/A INTRINSIC
coiled coil region 176 217 N/A INTRINSIC
coiled coil region 311 338 N/A INTRINSIC
low complexity region 358 375 N/A INTRINSIC
SANT 446 494 2.76e-7 SMART
coiled coil region 516 541 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that mediates ligand-independent transcription repression of thyroid-hormone and retinoic-acid receptors by promoting chromatin condensation and preventing access of the transcription machinery. It is part of a complex which also includes histone deacetylases and transcriptional regulators similar to the yeast protein Sin3p. This gene is located between the Charcot-Marie-Tooth and Smith-Magenis syndrome critical regions on chromosome 17. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 17 and 20.[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a targeted mutation in this gene exhibit embryonic lethality with erythrocytic, thymocytic and central nervous system development abnormalities. Mice homozygous for a hypomorphic allele exhibit increased thyroid hormone sensitivity under hypothyroid conditions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik A T 1: 26,685,270 N276K probably benign Het
9830107B12Rik T A 17: 48,145,579 Y63F possibly damaging Het
Abi1 A T 2: 22,946,584 I421N probably benign Het
Ahnak A G 19: 9,016,156 I4935V probably benign Het
Atg12 A C 18: 46,734,484 V131G probably damaging Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 CACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGT CACTGGTTCTGTGGTGACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGT 3: 95,888,138 probably benign Het
BC028528 TTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGG TTCTGTGGTCACTGGGTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGG 3: 95,888,144 probably benign Het
Bcl3 C T 7: 19,812,494 V139I probably damaging Het
Bloc1s4 T A 5: 36,748,345 M101L probably benign Het
Bmp6 C T 13: 38,346,257 Q109* probably null Het
Cabyr C T 18: 12,744,599 T28I possibly damaging Het
Catsper3 T C 13: 55,784,725 S22P probably benign Het
Catsperg2 A T 7: 29,712,981 C395S probably null Het
Cd101 T C 3: 101,018,792 T208A probably benign Het
Chaf1a A G 17: 56,064,148 S678G probably benign Het
Chrna2 A C 14: 66,151,035 I500L probably benign Het
Cln6 C T 9: 62,850,757 T266I possibly damaging Het
Col17a1 T A 19: 47,671,524 T330S possibly damaging Het
Cyp2d40 A G 15: 82,760,774 V225A unknown Het
Dnah10 A G 5: 124,799,031 N2645D probably damaging Het
Dph5 T A 3: 115,892,797 V74D probably benign Het
Dthd1 A T 5: 62,843,092 I586L probably damaging Het
Elane G A 10: 79,887,045 R95Q probably benign Het
Fbxw17 A G 13: 50,433,362 T453A probably damaging Het
Fpr3 C A 17: 17,970,965 T166K probably damaging Het
Fryl A G 5: 73,033,720 I2724T probably benign Het
Fsip2 C T 2: 82,949,512 R201C probably damaging Het
Gm14496 T A 2: 181,991,257 F11Y possibly damaging Het
Gm14496 A G 2: 182,000,837 N767S probably damaging Het
Hyal4 T A 6: 24,765,934 M429K possibly damaging Het
Itgad A T 7: 128,183,015 T208S probably damaging Het
Itpr3 T G 17: 27,110,888 L1552R probably benign Het
Kcp C T 6: 29,499,187 C292Y probably damaging Het
Kdr T C 5: 75,948,843 K958R probably damaging Het
Klhl22 T A 16: 17,789,284 W485R probably damaging Het
Ldhb T A 6: 142,492,519 I271F possibly damaging Het
Lmo7 A G 14: 101,885,301 R309G probably damaging Het
Marco C A 1: 120,474,666 C517F probably damaging Het
Mpdz G A 4: 81,303,654 T1423I probably benign Het
Ncoa2 T C 1: 13,148,376 S1410G probably benign Het
Nlrp14 T A 7: 107,181,887 L97* probably null Het
Olfm3 T G 3: 115,122,744 S442A probably damaging Het
Olfr116 T C 17: 37,624,501 I45V probably damaging Het
Olfr1436 T C 19: 12,298,848 T95A probably benign Het
Olfr693 T C 7: 106,678,126 Y120C probably damaging Het
Olfr76 T A 19: 12,120,011 S234C probably benign Het
Olfr796 A G 10: 129,608,160 V107A possibly damaging Het
Pank4 G A 4: 154,980,550 V769I probably benign Het
Pdgfrb G A 18: 61,083,264 D1065N probably damaging Het
Ppp1r12a G A 10: 108,268,640 S911N probably benign Het
Prdx6b A G 2: 80,292,990 T48A probably damaging Het
Pttg1ip A G 10: 77,597,036 K166E probably damaging Het
Rabgap1l T C 1: 160,251,417 D9G Het
Rpl13a C T 7: 45,127,042 G69S probably benign Het
Rps6ka5 T A 12: 100,616,083 I177F probably damaging Het
Rttn C A 18: 89,060,479 A1343E probably damaging Het
Ryr2 C T 13: 11,560,653 V4820I possibly damaging Het
Slc12a7 A G 13: 73,790,772 I223V possibly damaging Het
Slc9a3 G A 13: 74,157,694 V277M probably damaging Het
Spata13 A T 14: 60,751,849 Y988F probably damaging Het
Spo11 A G 2: 172,992,071 I329V possibly damaging Het
Tcp11l2 A T 10: 84,587,134 D63V probably damaging Het
Tdrd3 G A 14: 87,506,593 W659* probably null Het
Thnsl2 T C 6: 71,141,327 D39G probably benign Het
Thumpd1 A T 7: 119,716,862 L288* probably null Het
Tram1l1 T C 3: 124,321,907 Y239H probably damaging Het
Usp38 T A 8: 80,981,972 E992D probably damaging Het
Usp45 A G 4: 21,784,790 T159A probably benign Het
Vmn1r218 C T 13: 23,136,660 T59I probably benign Het
Vmn2r70 T C 7: 85,565,291 I218V probably benign Het
Xpr1 T C 1: 155,307,742 I461V probably benign Het
Ydjc T C 16: 17,147,005 L8P probably damaging Het
Yme1l1 A T 2: 23,160,220 N21I possibly damaging Het
Zfhx4 T C 3: 5,390,366 L1140P probably benign Het
Other mutations in Ncor1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Ncor1 APN 11 62392528 missense probably damaging 1.00
IGL01343:Ncor1 APN 11 62325486 critical splice donor site probably null
IGL01392:Ncor1 APN 11 62340594 missense probably damaging 0.99
IGL01402:Ncor1 APN 11 62340474 missense probably damaging 1.00
IGL01714:Ncor1 APN 11 62334584 missense possibly damaging 0.58
IGL01772:Ncor1 APN 11 62349347 intron probably benign
IGL01889:Ncor1 APN 11 62334601 missense possibly damaging 0.69
IGL02058:Ncor1 APN 11 62344637 missense probably damaging 1.00
IGL02065:Ncor1 APN 11 62419609 missense possibly damaging 0.95
IGL02073:Ncor1 APN 11 62358917 missense probably damaging 0.99
IGL02176:Ncor1 APN 11 62329659 unclassified probably benign
IGL02288:Ncor1 APN 11 62349403 missense probably benign 0.01
IGL02348:Ncor1 APN 11 62333659 splice site probably benign
IGL02608:Ncor1 APN 11 62373214 missense probably benign 0.07
LCD18:Ncor1 UTSW 11 62419782 critical splice acceptor site probably benign
PIT4382001:Ncor1 UTSW 11 62344663 missense probably damaging 0.96
PIT4576001:Ncor1 UTSW 11 62333717 missense probably damaging 0.99
R0026:Ncor1 UTSW 11 62438429 missense probably damaging 1.00
R0038:Ncor1 UTSW 11 62392551 missense probably damaging 0.99
R0038:Ncor1 UTSW 11 62392551 missense probably damaging 0.99
R0103:Ncor1 UTSW 11 62343045 missense possibly damaging 0.85
R0103:Ncor1 UTSW 11 62343045 missense possibly damaging 0.85
R0144:Ncor1 UTSW 11 62392595 missense probably damaging 1.00
R0427:Ncor1 UTSW 11 62410920 missense probably damaging 1.00
R0501:Ncor1 UTSW 11 62373322 missense possibly damaging 0.73
R0544:Ncor1 UTSW 11 62333776 missense probably damaging 1.00
R0544:Ncor1 UTSW 11 62333777 missense probably damaging 1.00
R0563:Ncor1 UTSW 11 62343230 missense probably damaging 0.97
R1074:Ncor1 UTSW 11 62392551 missense probably damaging 0.99
R1266:Ncor1 UTSW 11 62334040 missense probably damaging 0.98
R1444:Ncor1 UTSW 11 62403806 missense probably damaging 1.00
R1452:Ncor1 UTSW 11 62334631 missense probably damaging 1.00
R1534:Ncor1 UTSW 11 62378504 missense possibly damaging 0.92
R1710:Ncor1 UTSW 11 62423005 missense probably damaging 1.00
R1762:Ncor1 UTSW 11 62384784 missense possibly damaging 0.82
R1771:Ncor1 UTSW 11 62327112 missense probably damaging 1.00
R1864:Ncor1 UTSW 11 62381419 missense probably damaging 1.00
R1902:Ncor1 UTSW 11 62338158 missense probably damaging 1.00
R1906:Ncor1 UTSW 11 62349385 missense possibly damaging 0.81
R2009:Ncor1 UTSW 11 62325601 missense probably benign 0.43
R3708:Ncor1 UTSW 11 62344687 missense probably damaging 1.00
R3825:Ncor1 UTSW 11 62373357 missense probably benign 0.00
R3923:Ncor1 UTSW 11 62325616 missense probably damaging 1.00
R3966:Ncor1 UTSW 11 62344757 missense probably damaging 1.00
R4049:Ncor1 UTSW 11 62329668 intron probably null
R4350:Ncor1 UTSW 11 62410818 critical splice donor site probably null
R4351:Ncor1 UTSW 11 62410818 critical splice donor site probably null
R4359:Ncor1 UTSW 11 62358910 missense probably damaging 1.00
R4712:Ncor1 UTSW 11 62344834 missense probably damaging 1.00
R4723:Ncor1 UTSW 11 62378612 missense probably benign 0.26
R4863:Ncor1 UTSW 11 62392638 missense possibly damaging 0.92
R4875:Ncor1 UTSW 11 62433611 small deletion probably benign
R4956:Ncor1 UTSW 11 62340605 missense probably damaging 1.00
R4993:Ncor1 UTSW 11 62343341 missense probably damaging 1.00
R5079:Ncor1 UTSW 11 62345237 missense possibly damaging 0.92
R5144:Ncor1 UTSW 11 62349464 missense probably damaging 1.00
R5223:Ncor1 UTSW 11 62339000 missense probably damaging 1.00
R5243:Ncor1 UTSW 11 62338962 missense probably damaging 1.00
R5271:Ncor1 UTSW 11 62340545 missense probably damaging 1.00
R5285:Ncor1 UTSW 11 62392649 missense probably damaging 1.00
R5533:Ncor1 UTSW 11 62343011 missense probably benign 0.00
R5580:Ncor1 UTSW 11 62389778 nonsense probably null
R5593:Ncor1 UTSW 11 62369304 missense probably damaging 1.00
R5609:Ncor1 UTSW 11 62358853 unclassified probably null
R5632:Ncor1 UTSW 11 62338234 missense possibly damaging 0.85
R5830:Ncor1 UTSW 11 62344763 missense possibly damaging 0.71
R5896:Ncor1 UTSW 11 62383190 missense probably damaging 1.00
R5973:Ncor1 UTSW 11 62349310 intron probably null
R6013:Ncor1 UTSW 11 62321077 missense probably benign
R6019:Ncor1 UTSW 11 62373161 missense probably benign 0.00
R6032:Ncor1 UTSW 11 62373321 missense possibly damaging 0.54
R6032:Ncor1 UTSW 11 62373321 missense possibly damaging 0.54
R6075:Ncor1 UTSW 11 62317849 missense probably damaging 1.00
R6091:Ncor1 UTSW 11 62419617 missense probably damaging 0.98
R6248:Ncor1 UTSW 11 62366982 missense probably damaging 1.00
R6281:Ncor1 UTSW 11 62373545 missense possibly damaging 0.71
R6351:Ncor1 UTSW 11 62373298 missense probably benign 0.30
R6469:Ncor1 UTSW 11 62343302 missense probably damaging 1.00
R6502:Ncor1 UTSW 11 62381414 nonsense probably null
R6614:Ncor1 UTSW 11 62330819 missense probably benign 0.01
R6650:Ncor1 UTSW 11 62334541 missense probably damaging 1.00
R6765:Ncor1 UTSW 11 62373446 missense probably benign 0.01
R6852:Ncor1 UTSW 11 62343245 missense probably damaging 0.97
R6909:Ncor1 UTSW 11 62329486 missense probably damaging 1.00
R6965:Ncor1 UTSW 11 62353233 critical splice donor site probably null
R7054:Ncor1 UTSW 11 62384793 missense probably null
R7248:Ncor1 UTSW 11 62384772 missense possibly damaging 0.89
R7352:Ncor1 UTSW 11 62333911 missense probably damaging 0.99
R7396:Ncor1 UTSW 11 62343218 missense probably damaging 0.99
R7434:Ncor1 UTSW 11 62383199 missense probably damaging 0.99
R7552:Ncor1 UTSW 11 62373424 missense possibly damaging 0.53
R7575:Ncor1 UTSW 11 62383256 missense probably benign 0.21
R7622:Ncor1 UTSW 11 62317968 missense probably benign 0.00
R7664:Ncor1 UTSW 11 62398328 missense probably damaging 1.00
R7814:Ncor1 UTSW 11 62333926 missense probably damaging 0.99
X0065:Ncor1 UTSW 11 62354569 critical splice donor site probably null
X0065:Ncor1 UTSW 11 62358991 missense probably benign 0.23
Z1176:Ncor1 UTSW 11 62438516 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TGAGTCCCACACATAAGTCATAGTC -3'
(R):5'- GGCAGGAATTTTAGTCCTAATTGG -3'

Sequencing Primer
(F):5'- AGTCACTTTCTAAATCAGTGCTTGC -3'
(R):5'- TAAGTGGTTTGCCTGCCT -3'
Posted On2019-10-17