Incidental Mutation 'R7565:Slc9a3'
ID585400
Institutional Source Beutler Lab
Gene Symbol Slc9a3
Ensembl Gene ENSMUSG00000036123
Gene Namesolute carrier family 9 (sodium/hydrogen exchanger), member 3
Synonyms9030624O13Rik, NHE-3, NHE3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7565 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location74121457-74169442 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 74157694 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 277 (V277M)
Ref Sequence ENSEMBL: ENSMUSP00000038142 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036208] [ENSMUST00000221703] [ENSMUST00000225423]
Predicted Effect probably damaging
Transcript: ENSMUST00000036208
AA Change: V277M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038142
Gene: ENSMUSG00000036123
AA Change: V277M

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Na_H_Exchanger 53 457 3.6e-87 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000221703
AA Change: V277M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000225423
AA Change: V277M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an epithelial brush border Na/H exchanger that uses an inward sodium ion gradient to expel acids from the cell. Defects in this gene are a cause of congenital secretory sodium diarrhea. Pseudogenes of this gene exist on chromosomes 10 and 22. [provided by RefSeq, Mar 2016]
PHENOTYPE: Homozygous mutant mice have diarrhea associated with defects of renal and intestinal absorption. Males are infertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik A T 1: 26,685,270 N276K probably benign Het
9830107B12Rik T A 17: 48,145,579 Y63F possibly damaging Het
Abi1 A T 2: 22,946,584 I421N probably benign Het
Ahnak A G 19: 9,016,156 I4935V probably benign Het
Atg12 A C 18: 46,734,484 V131G probably damaging Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 CACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGT CACTGGTTCTGTGGTGACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGT 3: 95,888,138 probably benign Het
BC028528 TTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGG TTCTGTGGTCACTGGGTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGG 3: 95,888,144 probably benign Het
Bcl3 C T 7: 19,812,494 V139I probably damaging Het
Bloc1s4 T A 5: 36,748,345 M101L probably benign Het
Bmp6 C T 13: 38,346,257 Q109* probably null Het
Cabyr C T 18: 12,744,599 T28I possibly damaging Het
Catsper3 T C 13: 55,784,725 S22P probably benign Het
Catsperg2 A T 7: 29,712,981 C395S probably null Het
Cd101 T C 3: 101,018,792 T208A probably benign Het
Chaf1a A G 17: 56,064,148 S678G probably benign Het
Chrna2 A C 14: 66,151,035 I500L probably benign Het
Cln6 C T 9: 62,850,757 T266I possibly damaging Het
Col17a1 T A 19: 47,671,524 T330S possibly damaging Het
Cyp2d40 A G 15: 82,760,774 V225A unknown Het
Dnah10 A G 5: 124,799,031 N2645D probably damaging Het
Dph5 T A 3: 115,892,797 V74D probably benign Het
Dthd1 A T 5: 62,843,092 I586L probably damaging Het
Elane G A 10: 79,887,045 R95Q probably benign Het
Fbxw17 A G 13: 50,433,362 T453A probably damaging Het
Fpr3 C A 17: 17,970,965 T166K probably damaging Het
Fryl A G 5: 73,033,720 I2724T probably benign Het
Fsip2 C T 2: 82,949,512 R201C probably damaging Het
Gm14496 T A 2: 181,991,257 F11Y possibly damaging Het
Gm14496 A G 2: 182,000,837 N767S probably damaging Het
Hyal4 T A 6: 24,765,934 M429K possibly damaging Het
Itgad A T 7: 128,183,015 T208S probably damaging Het
Itpr3 T G 17: 27,110,888 L1552R probably benign Het
Kcp C T 6: 29,499,187 C292Y probably damaging Het
Kdr T C 5: 75,948,843 K958R probably damaging Het
Klhl22 T A 16: 17,789,284 W485R probably damaging Het
Ldhb T A 6: 142,492,519 I271F possibly damaging Het
Lmo7 A G 14: 101,885,301 R309G probably damaging Het
Marco C A 1: 120,474,666 C517F probably damaging Het
Mpdz G A 4: 81,303,654 T1423I probably benign Het
Ncoa2 T C 1: 13,148,376 S1410G probably benign Het
Ncor1 T C 11: 62,401,265 N283S probably damaging Het
Nlrp14 T A 7: 107,181,887 L97* probably null Het
Olfm3 T G 3: 115,122,744 S442A probably damaging Het
Olfr116 T C 17: 37,624,501 I45V probably damaging Het
Olfr1436 T C 19: 12,298,848 T95A probably benign Het
Olfr693 T C 7: 106,678,126 Y120C probably damaging Het
Olfr76 T A 19: 12,120,011 S234C probably benign Het
Olfr796 A G 10: 129,608,160 V107A possibly damaging Het
Pank4 G A 4: 154,980,550 V769I probably benign Het
Pdgfrb G A 18: 61,083,264 D1065N probably damaging Het
Ppp1r12a G A 10: 108,268,640 S911N probably benign Het
Prdx6b A G 2: 80,292,990 T48A probably damaging Het
Pttg1ip A G 10: 77,597,036 K166E probably damaging Het
Rabgap1l T C 1: 160,251,417 D9G Het
Rpl13a C T 7: 45,127,042 G69S probably benign Het
Rps6ka5 T A 12: 100,616,083 I177F probably damaging Het
Rttn C A 18: 89,060,479 A1343E probably damaging Het
Ryr2 C T 13: 11,560,653 V4820I possibly damaging Het
Slc12a7 A G 13: 73,790,772 I223V possibly damaging Het
Spata13 A T 14: 60,751,849 Y988F probably damaging Het
Spo11 A G 2: 172,992,071 I329V possibly damaging Het
Tcp11l2 A T 10: 84,587,134 D63V probably damaging Het
Tdrd3 G A 14: 87,506,593 W659* probably null Het
Thnsl2 T C 6: 71,141,327 D39G probably benign Het
Thumpd1 A T 7: 119,716,862 L288* probably null Het
Tram1l1 T C 3: 124,321,907 Y239H probably damaging Het
Usp38 T A 8: 80,981,972 E992D probably damaging Het
Usp45 A G 4: 21,784,790 T159A probably benign Het
Vmn1r218 C T 13: 23,136,660 T59I probably benign Het
Vmn2r70 T C 7: 85,565,291 I218V probably benign Het
Xpr1 T C 1: 155,307,742 I461V probably benign Het
Ydjc T C 16: 17,147,005 L8P probably damaging Het
Yme1l1 A T 2: 23,160,220 N21I possibly damaging Het
Zfhx4 T C 3: 5,390,366 L1140P probably benign Het
Other mutations in Slc9a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Slc9a3 APN 13 74160302 missense probably benign 0.19
IGL01299:Slc9a3 APN 13 74160263 missense probably benign 0.33
IGL01390:Slc9a3 APN 13 74150761 missense probably benign 0.01
IGL01814:Slc9a3 APN 13 74165972 missense probably damaging 0.96
IGL02020:Slc9a3 APN 13 74158848 missense probably damaging 0.99
IGL02072:Slc9a3 APN 13 74165859 missense probably benign 0.00
IGL02186:Slc9a3 APN 13 74163114 missense possibly damaging 0.94
IGL02878:Slc9a3 APN 13 74165357 nonsense probably null
IGL03056:Slc9a3 APN 13 74150819 missense probably damaging 1.00
R0090:Slc9a3 UTSW 13 74158728 missense probably damaging 0.99
R0280:Slc9a3 UTSW 13 74159424 missense probably damaging 1.00
R0359:Slc9a3 UTSW 13 74157607 missense probably damaging 1.00
R0388:Slc9a3 UTSW 13 74121536 missense unknown
R0396:Slc9a3 UTSW 13 74157784 critical splice donor site probably null
R0893:Slc9a3 UTSW 13 74159246 missense probably damaging 1.00
R1169:Slc9a3 UTSW 13 74150743 missense probably damaging 0.98
R1640:Slc9a3 UTSW 13 74158818 missense probably damaging 1.00
R1769:Slc9a3 UTSW 13 74163071 missense probably benign 0.00
R1850:Slc9a3 UTSW 13 74161770 missense probably benign 0.34
R1937:Slc9a3 UTSW 13 74166056 splice site probably null
R2048:Slc9a3 UTSW 13 74163741 missense probably damaging 1.00
R2146:Slc9a3 UTSW 13 74121603 missense probably benign 0.00
R2495:Slc9a3 UTSW 13 74158703 missense probably damaging 0.99
R2883:Slc9a3 UTSW 13 74158760 missense probably damaging 1.00
R2938:Slc9a3 UTSW 13 74121669 missense possibly damaging 0.62
R4538:Slc9a3 UTSW 13 74161732 missense possibly damaging 0.56
R4580:Slc9a3 UTSW 13 74158886 nonsense probably null
R4581:Slc9a3 UTSW 13 74164165 missense probably damaging 0.99
R4841:Slc9a3 UTSW 13 74165837 missense probably damaging 1.00
R4928:Slc9a3 UTSW 13 74157719 missense probably damaging 1.00
R4965:Slc9a3 UTSW 13 74164293 missense possibly damaging 0.62
R5079:Slc9a3 UTSW 13 74164287 missense probably damaging 0.97
R5329:Slc9a3 UTSW 13 74150960 missense possibly damaging 0.94
R5663:Slc9a3 UTSW 13 74163712 missense probably damaging 0.98
R5876:Slc9a3 UTSW 13 74161723 missense probably damaging 1.00
R5919:Slc9a3 UTSW 13 74158740 missense probably damaging 0.98
R6060:Slc9a3 UTSW 13 74150885 missense probably damaging 1.00
R6562:Slc9a3 UTSW 13 74155161 missense probably damaging 1.00
R6645:Slc9a3 UTSW 13 74164172 missense probably damaging 0.99
R7145:Slc9a3 UTSW 13 74150678 missense probably damaging 0.99
R7422:Slc9a3 UTSW 13 74150885 missense probably damaging 1.00
R7679:Slc9a3 UTSW 13 74160276 missense possibly damaging 0.88
R8032:Slc9a3 UTSW 13 74157644 missense probably damaging 1.00
R8080:Slc9a3 UTSW 13 74166027 missense probably benign 0.30
R8158:Slc9a3 UTSW 13 74155122 missense probably damaging 1.00
R8159:Slc9a3 UTSW 13 74164288 missense probably benign 0.01
Z1176:Slc9a3 UTSW 13 74165856 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTGCCAGGAGCTTTCCATGG -3'
(R):5'- GATACCCTCTGCTCACAGTG -3'

Sequencing Primer
(F):5'- GGGAATGAGTAGCCAACCTGTC -3'
(R):5'- CCTTCTGCCGGAGTTTAAATGCAG -3'
Posted On2019-10-17