Incidental Mutation 'R7565:Chrna2'
ID585402
Institutional Source Beutler Lab
Gene Symbol Chrna2
Ensembl Gene ENSMUSG00000022041
Gene Namecholinergic receptor, nicotinic, alpha polypeptide 2 (neuronal)
SynonymsAcra-2, Acra2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7565 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location66135039-66152948 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 66151035 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 500 (I500L)
Ref Sequence ENSEMBL: ENSMUSP00000022620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022620] [ENSMUST00000022622] [ENSMUST00000089250] [ENSMUST00000111121] [ENSMUST00000178730] [ENSMUST00000206455]
Predicted Effect probably benign
Transcript: ENSMUST00000022620
AA Change: I500L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000022620
Gene: ENSMUSG00000022041
AA Change: I500L

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 36 242 2.2e-81 PFAM
Pfam:Neur_chan_memb 249 503 5e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000022622
SMART Domains Protein: ENSMUSP00000022622
Gene: ENSMUSG00000059456

DomainStartEndE-ValueType
B41 35 265 1.33e-45 SMART
TyrKc 425 679 1.46e-139 SMART
low complexity region 713 726 N/A INTRINSIC
Pfam:Focal_AT 870 1008 1.7e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000089250
SMART Domains Protein: ENSMUSP00000086661
Gene: ENSMUSG00000059456

DomainStartEndE-ValueType
B41 35 265 1.33e-45 SMART
TyrKc 425 679 1.46e-139 SMART
low complexity region 713 726 N/A INTRINSIC
Pfam:Focal_AT 828 966 2e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111121
SMART Domains Protein: ENSMUSP00000106750
Gene: ENSMUSG00000059456

DomainStartEndE-ValueType
B41 35 265 1.33e-45 SMART
TyrKc 425 679 1.46e-139 SMART
low complexity region 713 726 N/A INTRINSIC
Pfam:Focal_AT 866 1004 1.1e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154865
SMART Domains Protein: ENSMUSP00000122683
Gene: ENSMUSG00000059456

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 83 8.5e-27 PFAM
low complexity region 117 130 N/A INTRINSIC
Pfam:Focal_AT 243 375 5e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178730
SMART Domains Protein: ENSMUSP00000137008
Gene: ENSMUSG00000059456

DomainStartEndE-ValueType
B41 35 265 1.33e-45 SMART
TyrKc 425 679 1.46e-139 SMART
low complexity region 713 726 N/A INTRINSIC
Pfam:Focal_AT 870 1002 2.1e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000206455
AA Change: I500L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nicotinic acetylcholine receptors (nAChRs) are ligand-gated ion channels formed by a pentameric arrangement of alpha and beta subunits to create distinct muscle and neuronal receptors. Neuronal receptors are found throughout the peripheral and central nervous system where they are involved in fast synaptic transmission. This gene encodes an alpha subunit that is widely expressed in the brain. The proposed structure for nAChR subunits is a conserved N-terminal extracellular domain followed by three conserved transmembrane domains, a variable cytoplasmic loop, a fourth conserved transmembrane domain, and a short C-terminal extracellular region. Mutations in this gene cause autosomal dominant nocturnal frontal lobe epilepsy type 4. Single nucleotide polymorphisms (SNPs) in this gene have been associated with nicotine dependence. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a targeted null mutation do not exhibit any significant abnormalities compared to controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik A T 1: 26,685,270 N276K probably benign Het
9830107B12Rik T A 17: 48,145,579 Y63F possibly damaging Het
Abi1 A T 2: 22,946,584 I421N probably benign Het
Ahnak A G 19: 9,016,156 I4935V probably benign Het
Atg12 A C 18: 46,734,484 V131G probably damaging Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 CACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGT CACTGGTTCTGTGGTGACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGT 3: 95,888,138 probably benign Het
BC028528 TTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGG TTCTGTGGTCACTGGGTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGG 3: 95,888,144 probably benign Het
Bcl3 C T 7: 19,812,494 V139I probably damaging Het
Bloc1s4 T A 5: 36,748,345 M101L probably benign Het
Bmp6 C T 13: 38,346,257 Q109* probably null Het
Cabyr C T 18: 12,744,599 T28I possibly damaging Het
Catsper3 T C 13: 55,784,725 S22P probably benign Het
Catsperg2 A T 7: 29,712,981 C395S probably null Het
Cd101 T C 3: 101,018,792 T208A probably benign Het
Chaf1a A G 17: 56,064,148 S678G probably benign Het
Cln6 C T 9: 62,850,757 T266I possibly damaging Het
Col17a1 T A 19: 47,671,524 T330S possibly damaging Het
Cyp2d40 A G 15: 82,760,774 V225A unknown Het
Dnah10 A G 5: 124,799,031 N2645D probably damaging Het
Dph5 T A 3: 115,892,797 V74D probably benign Het
Dthd1 A T 5: 62,843,092 I586L probably damaging Het
Elane G A 10: 79,887,045 R95Q probably benign Het
Fbxw17 A G 13: 50,433,362 T453A probably damaging Het
Fpr3 C A 17: 17,970,965 T166K probably damaging Het
Fryl A G 5: 73,033,720 I2724T probably benign Het
Fsip2 C T 2: 82,949,512 R201C probably damaging Het
Gm14496 T A 2: 181,991,257 F11Y possibly damaging Het
Gm14496 A G 2: 182,000,837 N767S probably damaging Het
Hyal4 T A 6: 24,765,934 M429K possibly damaging Het
Itgad A T 7: 128,183,015 T208S probably damaging Het
Itpr3 T G 17: 27,110,888 L1552R probably benign Het
Kcp C T 6: 29,499,187 C292Y probably damaging Het
Kdr T C 5: 75,948,843 K958R probably damaging Het
Klhl22 T A 16: 17,789,284 W485R probably damaging Het
Ldhb T A 6: 142,492,519 I271F possibly damaging Het
Lmo7 A G 14: 101,885,301 R309G probably damaging Het
Marco C A 1: 120,474,666 C517F probably damaging Het
Mpdz G A 4: 81,303,654 T1423I probably benign Het
Ncoa2 T C 1: 13,148,376 S1410G probably benign Het
Ncor1 T C 11: 62,401,265 N283S probably damaging Het
Nlrp14 T A 7: 107,181,887 L97* probably null Het
Olfm3 T G 3: 115,122,744 S442A probably damaging Het
Olfr116 T C 17: 37,624,501 I45V probably damaging Het
Olfr1436 T C 19: 12,298,848 T95A probably benign Het
Olfr693 T C 7: 106,678,126 Y120C probably damaging Het
Olfr76 T A 19: 12,120,011 S234C probably benign Het
Olfr796 A G 10: 129,608,160 V107A possibly damaging Het
Pank4 G A 4: 154,980,550 V769I probably benign Het
Pdgfrb G A 18: 61,083,264 D1065N probably damaging Het
Ppp1r12a G A 10: 108,268,640 S911N probably benign Het
Prdx6b A G 2: 80,292,990 T48A probably damaging Het
Pttg1ip A G 10: 77,597,036 K166E probably damaging Het
Rabgap1l T C 1: 160,251,417 D9G Het
Rpl13a C T 7: 45,127,042 G69S probably benign Het
Rps6ka5 T A 12: 100,616,083 I177F probably damaging Het
Rttn C A 18: 89,060,479 A1343E probably damaging Het
Ryr2 C T 13: 11,560,653 V4820I possibly damaging Het
Slc12a7 A G 13: 73,790,772 I223V possibly damaging Het
Slc9a3 G A 13: 74,157,694 V277M probably damaging Het
Spata13 A T 14: 60,751,849 Y988F probably damaging Het
Spo11 A G 2: 172,992,071 I329V possibly damaging Het
Tcp11l2 A T 10: 84,587,134 D63V probably damaging Het
Tdrd3 G A 14: 87,506,593 W659* probably null Het
Thnsl2 T C 6: 71,141,327 D39G probably benign Het
Thumpd1 A T 7: 119,716,862 L288* probably null Het
Tram1l1 T C 3: 124,321,907 Y239H probably damaging Het
Usp38 T A 8: 80,981,972 E992D probably damaging Het
Usp45 A G 4: 21,784,790 T159A probably benign Het
Vmn1r218 C T 13: 23,136,660 T59I probably benign Het
Vmn2r70 T C 7: 85,565,291 I218V probably benign Het
Xpr1 T C 1: 155,307,742 I461V probably benign Het
Ydjc T C 16: 17,147,005 L8P probably damaging Het
Yme1l1 A T 2: 23,160,220 N21I possibly damaging Het
Zfhx4 T C 3: 5,390,366 L1140P probably benign Het
Other mutations in Chrna2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02738:Chrna2 APN 14 66149440 missense probably benign 0.01
IGL03172:Chrna2 APN 14 66142239 missense probably benign
IGL03268:Chrna2 APN 14 66150946 splice site probably benign
IGL03344:Chrna2 APN 14 66150966 missense probably damaging 0.99
PIT1430001:Chrna2 UTSW 14 66149737 missense probably benign 0.01
R0511:Chrna2 UTSW 14 66149104 missense probably damaging 1.00
R0631:Chrna2 UTSW 14 66149308 missense probably benign 0.45
R1205:Chrna2 UTSW 14 66143363 missense probably benign 0.00
R1485:Chrna2 UTSW 14 66143363 missense probably benign 0.00
R1487:Chrna2 UTSW 14 66143363 missense probably benign 0.00
R1513:Chrna2 UTSW 14 66143429 missense probably benign 0.13
R2023:Chrna2 UTSW 14 66142228 missense probably benign 0.25
R2094:Chrna2 UTSW 14 66149463 missense possibly damaging 0.65
R2964:Chrna2 UTSW 14 66149368 missense possibly damaging 0.82
R2966:Chrna2 UTSW 14 66149368 missense possibly damaging 0.82
R3118:Chrna2 UTSW 14 66150993 missense probably damaging 0.98
R3931:Chrna2 UTSW 14 66149767 missense probably benign 0.26
R3979:Chrna2 UTSW 14 66148953 missense probably damaging 1.00
R3983:Chrna2 UTSW 14 66149457 missense probably benign 0.00
R4080:Chrna2 UTSW 14 66143417 missense probably benign 0.12
R4080:Chrna2 UTSW 14 66143424 nonsense probably null
R4508:Chrna2 UTSW 14 66146453 missense probably damaging 1.00
R4661:Chrna2 UTSW 14 66148843 missense probably damaging 1.00
R4726:Chrna2 UTSW 14 66148896 missense possibly damaging 0.85
R5349:Chrna2 UTSW 14 66143507 missense probably damaging 0.99
R5787:Chrna2 UTSW 14 66149008 missense probably benign 0.16
R6967:Chrna2 UTSW 14 66150949 critical splice acceptor site probably null
R7218:Chrna2 UTSW 14 66143871 intron probably null
R7274:Chrna2 UTSW 14 66149226 missense probably benign 0.03
Z1176:Chrna2 UTSW 14 66149304 missense not run
Z1177:Chrna2 UTSW 14 66151027 missense not run
Predicted Primers PCR Primer
(F):5'- TGGTGACTACTGCCTCCATGAG -3'
(R):5'- AGTGCTTGTCACCGCAATG -3'

Sequencing Primer
(F):5'- CCTCCATGAGGCTGGATGTG -3'
(R):5'- TGGCACCATGAACTGTTGAC -3'
Posted On2019-10-17