Incidental Mutation 'R7565:Lmo7'
ID585404
Institutional Source Beutler Lab
Gene Symbol Lmo7
Ensembl Gene ENSMUSG00000033060
Gene NameLIM domain only 7
SynonymsFBXO20, LOC380928
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R7565 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location101729957-101934710 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 101885301 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 309 (R309G)
Ref Sequence ENSEMBL: ENSMUSP00000097910 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100337] [ENSMUST00000159026] [ENSMUST00000159258] [ENSMUST00000159314] [ENSMUST00000159597]
Predicted Effect probably damaging
Transcript: ENSMUST00000100337
AA Change: R309G

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097910
Gene: ENSMUSG00000033060
AA Change: R309G

DomainStartEndE-ValueType
CH 14 124 2.57e-13 SMART
low complexity region 200 211 N/A INTRINSIC
Pfam:DUF4757 242 348 2.2e-14 PFAM
low complexity region 448 462 N/A INTRINSIC
Pfam:DUF4757 568 735 1.8e-46 PFAM
low complexity region 861 879 N/A INTRINSIC
low complexity region 979 991 N/A INTRINSIC
low complexity region 1003 1015 N/A INTRINSIC
PDZ 1047 1119 1.05e-8 SMART
coiled coil region 1222 1275 N/A INTRINSIC
coiled coil region 1319 1411 N/A INTRINSIC
low complexity region 1585 1596 N/A INTRINSIC
low complexity region 1599 1617 N/A INTRINSIC
LIM 1629 1687 6.54e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000159026
AA Change: R76G

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000124605
Gene: ENSMUSG00000033060
AA Change: R76G

DomainStartEndE-ValueType
low complexity region 215 229 N/A INTRINSIC
coiled coil region 435 471 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000159258
AA Change: R76G

PolyPhen 2 Score 0.631 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000125465
Gene: ENSMUSG00000033060
AA Change: R76G

DomainStartEndE-ValueType
low complexity region 215 229 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000159314
AA Change: R76G

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124349
Gene: ENSMUSG00000033060
AA Change: R76G

DomainStartEndE-ValueType
low complexity region 215 229 N/A INTRINSIC
coiled coil region 435 492 N/A INTRINSIC
low complexity region 628 646 N/A INTRINSIC
low complexity region 746 758 N/A INTRINSIC
low complexity region 770 782 N/A INTRINSIC
PDZ 814 886 1.05e-8 SMART
coiled coil region 989 1042 N/A INTRINSIC
coiled coil region 1086 1178 N/A INTRINSIC
low complexity region 1352 1363 N/A INTRINSIC
low complexity region 1366 1384 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000159597
AA Change: R187G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123706
Gene: ENSMUSG00000033060
AA Change: R187G

DomainStartEndE-ValueType
low complexity region 78 89 N/A INTRINSIC
internal_repeat_1 111 141 6.96e-5 PROSPERO
internal_repeat_1 218 248 6.96e-5 PROSPERO
low complexity region 326 340 N/A INTRINSIC
coiled coil region 546 603 N/A INTRINSIC
low complexity region 739 757 N/A INTRINSIC
low complexity region 857 869 N/A INTRINSIC
low complexity region 881 893 N/A INTRINSIC
PDZ 925 997 1.05e-8 SMART
coiled coil region 1127 1180 N/A INTRINSIC
coiled coil region 1224 1316 N/A INTRINSIC
low complexity region 1490 1501 N/A INTRINSIC
low complexity region 1504 1522 N/A INTRINSIC
LIM 1534 1592 6.54e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159806
SMART Domains Protein: ENSMUSP00000124300
Gene: ENSMUSG00000033060

DomainStartEndE-ValueType
low complexity region 34 45 N/A INTRINSIC
Pfam:DUF4757 76 225 4.5e-53 PFAM
low complexity region 351 369 N/A INTRINSIC
low complexity region 469 481 N/A INTRINSIC
low complexity region 493 505 N/A INTRINSIC
PDZ 537 609 1.05e-8 SMART
internal_repeat_1 620 691 9.31e-5 PROSPERO
coiled coil region 711 764 N/A INTRINSIC
coiled coil region 808 900 N/A INTRINSIC
internal_repeat_1 921 976 9.31e-5 PROSPERO
low complexity region 1075 1086 N/A INTRINSIC
low complexity region 1089 1107 N/A INTRINSIC
LIM 1119 1177 6.54e-10 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a calponin homology (CH) domain, a PDZ domain, and a LIM domain, and may be involved in protein-protein interactions. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene, however, the full-length nature of some variants is not known. [provided by RefSeq, Jan 2009]
PHENOTYPE: Targeted mutations in this gene result in postnatal lethality, growth defects, skeletal muscle abnormalities and retinal defects reflective of retinal degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik A T 1: 26,685,270 N276K probably benign Het
9830107B12Rik T A 17: 48,145,579 Y63F possibly damaging Het
Abi1 A T 2: 22,946,584 I421N probably benign Het
Ahnak A G 19: 9,016,156 I4935V probably benign Het
Atg12 A C 18: 46,734,484 V131G probably damaging Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 CACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGT CACTGGTTCTGTGGTGACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGT 3: 95,888,138 probably benign Het
BC028528 TTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGG TTCTGTGGTCACTGGGTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGG 3: 95,888,144 probably benign Het
Bcl3 C T 7: 19,812,494 V139I probably damaging Het
Bloc1s4 T A 5: 36,748,345 M101L probably benign Het
Bmp6 C T 13: 38,346,257 Q109* probably null Het
Cabyr C T 18: 12,744,599 T28I possibly damaging Het
Catsper3 T C 13: 55,784,725 S22P probably benign Het
Catsperg2 A T 7: 29,712,981 C395S probably null Het
Cd101 T C 3: 101,018,792 T208A probably benign Het
Chaf1a A G 17: 56,064,148 S678G probably benign Het
Chrna2 A C 14: 66,151,035 I500L probably benign Het
Cln6 C T 9: 62,850,757 T266I possibly damaging Het
Col17a1 T A 19: 47,671,524 T330S possibly damaging Het
Cyp2d40 A G 15: 82,760,774 V225A unknown Het
Dnah10 A G 5: 124,799,031 N2645D probably damaging Het
Dph5 T A 3: 115,892,797 V74D probably benign Het
Dthd1 A T 5: 62,843,092 I586L probably damaging Het
Elane G A 10: 79,887,045 R95Q probably benign Het
Fbxw17 A G 13: 50,433,362 T453A probably damaging Het
Fpr3 C A 17: 17,970,965 T166K probably damaging Het
Fryl A G 5: 73,033,720 I2724T probably benign Het
Fsip2 C T 2: 82,949,512 R201C probably damaging Het
Gm14496 A G 2: 182,000,837 N767S probably damaging Het
Gm14496 T A 2: 181,991,257 F11Y possibly damaging Het
Hyal4 T A 6: 24,765,934 M429K possibly damaging Het
Itgad A T 7: 128,183,015 T208S probably damaging Het
Itpr3 T G 17: 27,110,888 L1552R probably benign Het
Kcp C T 6: 29,499,187 C292Y probably damaging Het
Kdr T C 5: 75,948,843 K958R probably damaging Het
Klhl22 T A 16: 17,789,284 W485R probably damaging Het
Ldhb T A 6: 142,492,519 I271F possibly damaging Het
Marco C A 1: 120,474,666 C517F probably damaging Het
Mpdz G A 4: 81,303,654 T1423I probably benign Het
Ncoa2 T C 1: 13,148,376 S1410G probably benign Het
Ncor1 T C 11: 62,401,265 N283S probably damaging Het
Nlrp14 T A 7: 107,181,887 L97* probably null Het
Olfm3 T G 3: 115,122,744 S442A probably damaging Het
Olfr116 T C 17: 37,624,501 I45V probably damaging Het
Olfr1436 T C 19: 12,298,848 T95A probably benign Het
Olfr693 T C 7: 106,678,126 Y120C probably damaging Het
Olfr76 T A 19: 12,120,011 S234C probably benign Het
Olfr796 A G 10: 129,608,160 V107A possibly damaging Het
Pank4 G A 4: 154,980,550 V769I probably benign Het
Pdgfrb G A 18: 61,083,264 D1065N probably damaging Het
Ppp1r12a G A 10: 108,268,640 S911N probably benign Het
Prdx6b A G 2: 80,292,990 T48A probably damaging Het
Pttg1ip A G 10: 77,597,036 K166E probably damaging Het
Rabgap1l T C 1: 160,251,417 D9G Het
Rpl13a C T 7: 45,127,042 G69S probably benign Het
Rps6ka5 T A 12: 100,616,083 I177F probably damaging Het
Rttn C A 18: 89,060,479 A1343E probably damaging Het
Ryr2 C T 13: 11,560,653 V4820I possibly damaging Het
Slc12a7 A G 13: 73,790,772 I223V possibly damaging Het
Slc9a3 G A 13: 74,157,694 V277M probably damaging Het
Spata13 A T 14: 60,751,849 Y988F probably damaging Het
Spo11 A G 2: 172,992,071 I329V possibly damaging Het
Tcp11l2 A T 10: 84,587,134 D63V probably damaging Het
Tdrd3 G A 14: 87,506,593 W659* probably null Het
Thnsl2 T C 6: 71,141,327 D39G probably benign Het
Thumpd1 A T 7: 119,716,862 L288* probably null Het
Tram1l1 T C 3: 124,321,907 Y239H probably damaging Het
Usp38 T A 8: 80,981,972 E992D probably damaging Het
Usp45 A G 4: 21,784,790 T159A probably benign Het
Vmn1r218 C T 13: 23,136,660 T59I probably benign Het
Vmn2r70 T C 7: 85,565,291 I218V probably benign Het
Xpr1 T C 1: 155,307,742 I461V probably benign Het
Ydjc T C 16: 17,147,005 L8P probably damaging Het
Yme1l1 A T 2: 23,160,220 N21I possibly damaging Het
Zfhx4 T C 3: 5,390,366 L1140P probably benign Het
Other mutations in Lmo7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Lmo7 APN 14 101887051 missense probably damaging 0.99
IGL00733:Lmo7 APN 14 101915702 missense probably damaging 1.00
IGL00778:Lmo7 APN 14 101910885 splice site probably benign
IGL01014:Lmo7 APN 14 101920557 splice site probably benign
IGL01401:Lmo7 APN 14 101794277 nonsense probably null
IGL01550:Lmo7 APN 14 101926140 utr 3 prime probably benign
IGL01570:Lmo7 APN 14 101902371 critical splice donor site probably null
IGL01602:Lmo7 APN 14 101910756 splice site probably benign
IGL01605:Lmo7 APN 14 101910756 splice site probably benign
IGL02012:Lmo7 APN 14 101888716 intron probably benign
IGL02145:Lmo7 APN 14 101902223 missense probably benign 0.00
IGL02236:Lmo7 APN 14 101926088 splice site probably benign
IGL02318:Lmo7 APN 14 101900066 splice site probably benign
IGL02345:Lmo7 APN 14 101887473 missense probably damaging 1.00
IGL02498:Lmo7 APN 14 101807482 missense probably benign 0.01
IGL02583:Lmo7 APN 14 101933924 utr 3 prime probably benign
IGL02670:Lmo7 APN 14 101880980 missense probably damaging 1.00
IGL02694:Lmo7 APN 14 101887170 missense probably damaging 1.00
IGL03026:Lmo7 APN 14 101929333 utr 3 prime probably benign
IGL03062:Lmo7 APN 14 101912079 missense possibly damaging 0.66
IGL03068:Lmo7 APN 14 101875492 unclassified probably benign
IGL03178:Lmo7 APN 14 101929260 nonsense probably null
IGL03279:Lmo7 APN 14 101900508 missense probably benign 0.30
PIT4458001:Lmo7 UTSW 14 101887487 nonsense probably null
R0029:Lmo7 UTSW 14 101933921 utr 3 prime probably benign
R0112:Lmo7 UTSW 14 101887193 nonsense probably null
R0345:Lmo7 UTSW 14 101876877 missense probably damaging 1.00
R0372:Lmo7 UTSW 14 101918053 splice site probably benign
R0393:Lmo7 UTSW 14 101900456 missense probably benign
R0514:Lmo7 UTSW 14 101887173 missense probably damaging 1.00
R0514:Lmo7 UTSW 14 101896559 missense probably damaging 1.00
R0526:Lmo7 UTSW 14 101900560 missense probably damaging 1.00
R0615:Lmo7 UTSW 14 101876859 nonsense probably null
R0900:Lmo7 UTSW 14 101887188 missense probably damaging 1.00
R0961:Lmo7 UTSW 14 101794269 missense probably benign 0.00
R0964:Lmo7 UTSW 14 101920567 splice site probably benign
R1078:Lmo7 UTSW 14 101920474 splice site probably benign
R1252:Lmo7 UTSW 14 101900583 missense probably damaging 1.00
R1527:Lmo7 UTSW 14 101876828 missense probably damaging 1.00
R1537:Lmo7 UTSW 14 101929264 utr 3 prime probably benign
R1565:Lmo7 UTSW 14 101887521 missense probably damaging 0.99
R1637:Lmo7 UTSW 14 101880832 missense probably damaging 1.00
R1943:Lmo7 UTSW 14 101902302 missense probably damaging 1.00
R1967:Lmo7 UTSW 14 101900215 missense probably benign 0.36
R2002:Lmo7 UTSW 14 101887061 missense probably benign 0.13
R2057:Lmo7 UTSW 14 101887178 missense probably damaging 1.00
R2131:Lmo7 UTSW 14 101900238 missense probably damaging 0.99
R2153:Lmo7 UTSW 14 101920515 utr 3 prime probably benign
R2257:Lmo7 UTSW 14 101900130 missense probably damaging 1.00
R2355:Lmo7 UTSW 14 101888685 missense probably damaging 1.00
R2356:Lmo7 UTSW 14 101886945 missense probably damaging 1.00
R2898:Lmo7 UTSW 14 101876914 missense possibly damaging 0.93
R3847:Lmo7 UTSW 14 101922095 critical splice acceptor site probably null
R3848:Lmo7 UTSW 14 101922095 critical splice acceptor site probably null
R3849:Lmo7 UTSW 14 101922095 critical splice acceptor site probably null
R3916:Lmo7 UTSW 14 101929342 utr 3 prime probably benign
R4050:Lmo7 UTSW 14 101902277 nonsense probably null
R4326:Lmo7 UTSW 14 101900074 missense possibly damaging 0.93
R4357:Lmo7 UTSW 14 101887655 missense probably null 1.00
R4571:Lmo7 UTSW 14 101887594 missense probably damaging 0.96
R4658:Lmo7 UTSW 14 101886957 missense probably damaging 1.00
R4857:Lmo7 UTSW 14 101887348 splice site probably null
R5006:Lmo7 UTSW 14 101926237 utr 3 prime probably benign
R5528:Lmo7 UTSW 14 101902086 missense probably damaging 1.00
R5588:Lmo7 UTSW 14 101896590 splice site probably null
R5643:Lmo7 UTSW 14 101929336 utr 3 prime probably benign
R5644:Lmo7 UTSW 14 101929336 utr 3 prime probably benign
R5650:Lmo7 UTSW 14 101898674 missense probably damaging 1.00
R5737:Lmo7 UTSW 14 101887236 missense probably damaging 1.00
R5832:Lmo7 UTSW 14 101884213 missense probably damaging 1.00
R5966:Lmo7 UTSW 14 101900502 missense possibly damaging 0.92
R6026:Lmo7 UTSW 14 101880990 missense probably benign 0.04
R6072:Lmo7 UTSW 14 101929336 utr 3 prime probably benign
R6158:Lmo7 UTSW 14 101900137 missense probably benign 0.03
R6246:Lmo7 UTSW 14 101918700 missense probably damaging 1.00
R6335:Lmo7 UTSW 14 101900636 missense probably damaging 1.00
R6620:Lmo7 UTSW 14 101875452 missense probably benign 0.29
R6658:Lmo7 UTSW 14 101910845 missense possibly damaging 0.84
R6917:Lmo7 UTSW 14 101918010 missense probably damaging 1.00
R7064:Lmo7 UTSW 14 101884179 missense probably damaging 1.00
R7072:Lmo7 UTSW 14 101898700 critical splice donor site probably null
R7121:Lmo7 UTSW 14 101887035 missense probably damaging 1.00
R7136:Lmo7 UTSW 14 101920539 missense unknown
R7196:Lmo7 UTSW 14 101896500 missense possibly damaging 0.75
R7228:Lmo7 UTSW 14 101896535 missense probably damaging 0.99
R7337:Lmo7 UTSW 14 101884204 missense probably damaging 0.98
R7341:Lmo7 UTSW 14 101885512 missense probably benign 0.30
R7408:Lmo7 UTSW 14 101880953 missense probably damaging 1.00
R7432:Lmo7 UTSW 14 101902115 missense probably benign 0.42
R7470:Lmo7 UTSW 14 101900604 missense possibly damaging 0.83
R7506:Lmo7 UTSW 14 101919609 missense unknown
R7559:Lmo7 UTSW 14 101887226 nonsense probably null
R7788:Lmo7 UTSW 14 101898576 missense possibly damaging 0.64
R8095:Lmo7 UTSW 14 101887419 missense possibly damaging 0.88
R8100:Lmo7 UTSW 14 101900463 missense probably benign 0.33
R8121:Lmo7 UTSW 14 101926300 missense unknown
R8308:Lmo7 UTSW 14 101902371 critical splice donor site probably null
R8371:Lmo7 UTSW 14 101887008 missense possibly damaging 0.95
R8403:Lmo7 UTSW 14 101902364 missense probably benign 0.03
R8690:Lmo7 UTSW 14 101931208 missense unknown
R8778:Lmo7 UTSW 14 101912067 missense probably damaging 0.98
R8778:Lmo7 UTSW 14 101919219 missense probably benign 0.24
R8822:Lmo7 UTSW 14 101884174 missense probably damaging 1.00
X0066:Lmo7 UTSW 14 101887461 missense probably damaging 1.00
X0067:Lmo7 UTSW 14 101886933 splice site probably null
Z1176:Lmo7 UTSW 14 101884306 missense probably damaging 0.99
Z1176:Lmo7 UTSW 14 101919281 missense probably benign 0.00
Z1176:Lmo7 UTSW 14 101919443 missense unknown
Z1176:Lmo7 UTSW 14 101929228 missense unknown
Z1177:Lmo7 UTSW 14 101896518 missense possibly damaging 0.96
Z1177:Lmo7 UTSW 14 101898557 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCTTAACATAGCCCTGGGTATC -3'
(R):5'- CAAAAGAGCTCCCTGGACTTG -3'

Sequencing Primer
(F):5'- CCAGCTTTTCTCTAGCTAAAGTGAGG -3'
(R):5'- TCCCTGGACTTGGCATGAC -3'
Posted On2019-10-17