Incidental Mutation 'R7565:Olfr116'
ID585410
Institutional Source Beutler Lab
Gene Symbol Olfr116
Ensembl Gene ENSMUSG00000061336
Gene Nameolfactory receptor 116
SynonymsMOR218-2, GA_x6K02T2PSCP-2084102-2083137
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R7565 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location37620577-37627199 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37624501 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 45 (I45V)
Ref Sequence ENSEMBL: ENSMUSP00000150977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072265] [ENSMUST00000216128] [ENSMUST00000223366]
Predicted Effect probably damaging
Transcript: ENSMUST00000072265
AA Change: I45V

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000072115
Gene: ENSMUSG00000061336
AA Change: I45V

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.9e-45 PFAM
Pfam:7TM_GPCR_Srsx 35 305 2.1e-6 PFAM
Pfam:7tm_1 41 290 6.1e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216128
AA Change: I45V

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000223366
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik A T 1: 26,685,270 N276K probably benign Het
9830107B12Rik T A 17: 48,145,579 Y63F possibly damaging Het
Abi1 A T 2: 22,946,584 I421N probably benign Het
Ahnak A G 19: 9,016,156 I4935V probably benign Het
Atg12 A C 18: 46,734,484 V131G probably damaging Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 CACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGT CACTGGTTCTGTGGTGACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGT 3: 95,888,138 probably benign Het
BC028528 TTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGG TTCTGTGGTCACTGGGTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGG 3: 95,888,144 probably benign Het
Bcl3 C T 7: 19,812,494 V139I probably damaging Het
Bloc1s4 T A 5: 36,748,345 M101L probably benign Het
Bmp6 C T 13: 38,346,257 Q109* probably null Het
Cabyr C T 18: 12,744,599 T28I possibly damaging Het
Catsper3 T C 13: 55,784,725 S22P probably benign Het
Catsperg2 A T 7: 29,712,981 C395S probably null Het
Cd101 T C 3: 101,018,792 T208A probably benign Het
Chaf1a A G 17: 56,064,148 S678G probably benign Het
Chrna2 A C 14: 66,151,035 I500L probably benign Het
Cln6 C T 9: 62,850,757 T266I possibly damaging Het
Col17a1 T A 19: 47,671,524 T330S possibly damaging Het
Cyp2d40 A G 15: 82,760,774 V225A unknown Het
Dnah10 A G 5: 124,799,031 N2645D probably damaging Het
Dph5 T A 3: 115,892,797 V74D probably benign Het
Dthd1 A T 5: 62,843,092 I586L probably damaging Het
Elane G A 10: 79,887,045 R95Q probably benign Het
Fbxw17 A G 13: 50,433,362 T453A probably damaging Het
Fpr3 C A 17: 17,970,965 T166K probably damaging Het
Fryl A G 5: 73,033,720 I2724T probably benign Het
Fsip2 C T 2: 82,949,512 R201C probably damaging Het
Gm14496 T A 2: 181,991,257 F11Y possibly damaging Het
Gm14496 A G 2: 182,000,837 N767S probably damaging Het
Hyal4 T A 6: 24,765,934 M429K possibly damaging Het
Itgad A T 7: 128,183,015 T208S probably damaging Het
Itpr3 T G 17: 27,110,888 L1552R probably benign Het
Kcp C T 6: 29,499,187 C292Y probably damaging Het
Kdr T C 5: 75,948,843 K958R probably damaging Het
Klhl22 T A 16: 17,789,284 W485R probably damaging Het
Ldhb T A 6: 142,492,519 I271F possibly damaging Het
Lmo7 A G 14: 101,885,301 R309G probably damaging Het
Marco C A 1: 120,474,666 C517F probably damaging Het
Mpdz G A 4: 81,303,654 T1423I probably benign Het
Ncoa2 T C 1: 13,148,376 S1410G probably benign Het
Ncor1 T C 11: 62,401,265 N283S probably damaging Het
Nlrp14 T A 7: 107,181,887 L97* probably null Het
Olfm3 T G 3: 115,122,744 S442A probably damaging Het
Olfr1436 T C 19: 12,298,848 T95A probably benign Het
Olfr693 T C 7: 106,678,126 Y120C probably damaging Het
Olfr76 T A 19: 12,120,011 S234C probably benign Het
Olfr796 A G 10: 129,608,160 V107A possibly damaging Het
Pank4 G A 4: 154,980,550 V769I probably benign Het
Pdgfrb G A 18: 61,083,264 D1065N probably damaging Het
Ppp1r12a G A 10: 108,268,640 S911N probably benign Het
Prdx6b A G 2: 80,292,990 T48A probably damaging Het
Pttg1ip A G 10: 77,597,036 K166E probably damaging Het
Rabgap1l T C 1: 160,251,417 D9G Het
Rpl13a C T 7: 45,127,042 G69S probably benign Het
Rps6ka5 T A 12: 100,616,083 I177F probably damaging Het
Rttn C A 18: 89,060,479 A1343E probably damaging Het
Ryr2 C T 13: 11,560,653 V4820I possibly damaging Het
Slc12a7 A G 13: 73,790,772 I223V possibly damaging Het
Slc9a3 G A 13: 74,157,694 V277M probably damaging Het
Spata13 A T 14: 60,751,849 Y988F probably damaging Het
Spo11 A G 2: 172,992,071 I329V possibly damaging Het
Tcp11l2 A T 10: 84,587,134 D63V probably damaging Het
Tdrd3 G A 14: 87,506,593 W659* probably null Het
Thnsl2 T C 6: 71,141,327 D39G probably benign Het
Thumpd1 A T 7: 119,716,862 L288* probably null Het
Tram1l1 T C 3: 124,321,907 Y239H probably damaging Het
Usp38 T A 8: 80,981,972 E992D probably damaging Het
Usp45 A G 4: 21,784,790 T159A probably benign Het
Vmn1r218 C T 13: 23,136,660 T59I probably benign Het
Vmn2r70 T C 7: 85,565,291 I218V probably benign Het
Xpr1 T C 1: 155,307,742 I461V probably benign Het
Ydjc T C 16: 17,147,005 L8P probably damaging Het
Yme1l1 A T 2: 23,160,220 N21I possibly damaging Het
Zfhx4 T C 3: 5,390,366 L1140P probably benign Het
Other mutations in Olfr116
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02434:Olfr116 APN 17 37624576 missense possibly damaging 0.86
IGL02639:Olfr116 APN 17 37623987 missense probably benign 0.01
IGL02663:Olfr116 APN 17 37624044 missense probably benign 0.37
R0049:Olfr116 UTSW 17 37624133 missense probably benign 0.02
R1260:Olfr116 UTSW 17 37623703 missense probably benign 0.00
R1531:Olfr116 UTSW 17 37624352 nonsense probably null
R3236:Olfr116 UTSW 17 37624236 missense possibly damaging 0.65
R4083:Olfr116 UTSW 17 37624425 missense probably damaging 1.00
R4308:Olfr116 UTSW 17 37623736 missense possibly damaging 0.46
R4887:Olfr116 UTSW 17 37623891 missense probably damaging 0.99
R5167:Olfr116 UTSW 17 37623751 nonsense probably null
R5323:Olfr116 UTSW 17 37624155 missense probably benign 0.22
R5496:Olfr116 UTSW 17 37624578 missense probably benign 0.01
R5530:Olfr116 UTSW 17 37623807 missense possibly damaging 0.72
R5643:Olfr116 UTSW 17 37624432 missense probably benign 0.00
R5644:Olfr116 UTSW 17 37624432 missense probably benign 0.00
R5798:Olfr116 UTSW 17 37623990 missense probably benign 0.01
R6020:Olfr116 UTSW 17 37623967 missense possibly damaging 0.94
R7058:Olfr116 UTSW 17 37623706 missense probably benign 0.00
R7453:Olfr116 UTSW 17 37624385 missense probably benign 0.00
R7474:Olfr116 UTSW 17 37624386 missense probably benign 0.30
R7646:Olfr116 UTSW 17 37624404 missense probably damaging 1.00
Z1088:Olfr116 UTSW 17 37624429 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTGAGAATAGCTACCTCACCC -3'
(R):5'- ATAGTGTGAGGTCTATGCAGATGAG -3'

Sequencing Primer
(F):5'- GAATAGCTACCTCACCCCAGGC -3'
(R):5'- TGCAGATGAGAAAAATGTGCTCTCAC -3'
Posted On2019-10-17