Incidental Mutation 'R7565:Pdgfrb'
ID585415
Institutional Source Beutler Lab
Gene Symbol Pdgfrb
Ensembl Gene ENSMUSG00000024620
Gene Nameplatelet derived growth factor receptor, beta polypeptide
SynonymsCD140b, Pdgfr
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_001146268.1, NM_008809.2; MGI:97531

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7565 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location61045150-61085061 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 61083264 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 1065 (D1065N)
Ref Sequence ENSEMBL: ENSMUSP00000110929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025522] [ENSMUST00000115274]
Predicted Effect probably damaging
Transcript: ENSMUST00000025522
AA Change: D1061N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025522
Gene: ENSMUSG00000024620
AA Change: D1061N

DomainStartEndE-ValueType
low complexity region 10 24 N/A INTRINSIC
IG 38 120 5.58e-2 SMART
IGc2 225 297 2.83e-12 SMART
IG_like 330 402 1.47e0 SMART
Pfam:Ig_2 415 524 5.6e-2 PFAM
transmembrane domain 534 556 N/A INTRINSIC
TyrKc 600 958 1.11e-135 SMART
low complexity region 1063 1083 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115274
AA Change: D1065N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110929
Gene: ENSMUSG00000024620
AA Change: D1065N

DomainStartEndE-ValueType
low complexity region 14 28 N/A INTRINSIC
IG 42 124 5.58e-2 SMART
IGc2 229 301 2.83e-12 SMART
IG_like 334 406 1.47e0 SMART
transmembrane domain 538 560 N/A INTRINSIC
TyrKc 604 962 1.11e-135 SMART
low complexity region 1067 1087 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype Strain: 2682393; 2135508
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell surface tyrosine kinase receptor for members of the platelet-derived growth factor family. These growth factors are mitogens for cells of mesenchymal origin. The identity of the growth factor bound to a receptor monomer determines whether the functional receptor is a homodimer or a heterodimer, composed of both platelet-derived growth factor receptor alpha and beta polypeptides. This gene is flanked on chromosome 5 by the genes for granulocyte-macrophage colony-stimulating factor and macrophage-colony stimulating factor receptor; all three genes may be implicated in the 5-q syndrome. A translocation between chromosomes 5 and 12, that fuses this gene to that of the translocation, ETV6, leukemia gene, results in chronic myeloproliferative disorder with eosinophilia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants die perinatally with internal bleeding, thrombocytopenia, anemia and kidney defects. A frameshift mutation results in neonatal lethals with edema and hemorrhaging; several point mutations show cardiovascular abnormalities. [provided by MGI curators]
Allele List at MGI

All alleles(25) : Targeted(23) Gene trapped(2)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik A T 1: 26,685,270 N276K probably benign Het
9830107B12Rik T A 17: 48,145,579 Y63F possibly damaging Het
Abi1 A T 2: 22,946,584 I421N probably benign Het
Ahnak A G 19: 9,016,156 I4935V probably benign Het
Atg12 A C 18: 46,734,484 V131G probably damaging Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 CACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGT CACTGGTTCTGTGGTGACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGT 3: 95,888,138 probably benign Het
BC028528 TTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGG TTCTGTGGTCACTGGGTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGG 3: 95,888,144 probably benign Het
Bcl3 C T 7: 19,812,494 V139I probably damaging Het
Bloc1s4 T A 5: 36,748,345 M101L probably benign Het
Bmp6 C T 13: 38,346,257 Q109* probably null Het
Cabyr C T 18: 12,744,599 T28I possibly damaging Het
Catsper3 T C 13: 55,784,725 S22P probably benign Het
Catsperg2 A T 7: 29,712,981 C395S probably null Het
Cd101 T C 3: 101,018,792 T208A probably benign Het
Chaf1a A G 17: 56,064,148 S678G probably benign Het
Chrna2 A C 14: 66,151,035 I500L probably benign Het
Cln6 C T 9: 62,850,757 T266I possibly damaging Het
Col17a1 T A 19: 47,671,524 T330S possibly damaging Het
Cyp2d40 A G 15: 82,760,774 V225A unknown Het
Dnah10 A G 5: 124,799,031 N2645D probably damaging Het
Dph5 T A 3: 115,892,797 V74D probably benign Het
Dthd1 A T 5: 62,843,092 I586L probably damaging Het
Elane G A 10: 79,887,045 R95Q probably benign Het
Fbxw17 A G 13: 50,433,362 T453A probably damaging Het
Fpr3 C A 17: 17,970,965 T166K probably damaging Het
Fryl A G 5: 73,033,720 I2724T probably benign Het
Fsip2 C T 2: 82,949,512 R201C probably damaging Het
Gm14496 T A 2: 181,991,257 F11Y possibly damaging Het
Gm14496 A G 2: 182,000,837 N767S probably damaging Het
Hyal4 T A 6: 24,765,934 M429K possibly damaging Het
Itgad A T 7: 128,183,015 T208S probably damaging Het
Itpr3 T G 17: 27,110,888 L1552R probably benign Het
Kcp C T 6: 29,499,187 C292Y probably damaging Het
Kdr T C 5: 75,948,843 K958R probably damaging Het
Klhl22 T A 16: 17,789,284 W485R probably damaging Het
Ldhb T A 6: 142,492,519 I271F possibly damaging Het
Lmo7 A G 14: 101,885,301 R309G probably damaging Het
Marco C A 1: 120,474,666 C517F probably damaging Het
Mpdz G A 4: 81,303,654 T1423I probably benign Het
Ncoa2 T C 1: 13,148,376 S1410G probably benign Het
Ncor1 T C 11: 62,401,265 N283S probably damaging Het
Nlrp14 T A 7: 107,181,887 L97* probably null Het
Olfm3 T G 3: 115,122,744 S442A probably damaging Het
Olfr116 T C 17: 37,624,501 I45V probably damaging Het
Olfr1436 T C 19: 12,298,848 T95A probably benign Het
Olfr693 T C 7: 106,678,126 Y120C probably damaging Het
Olfr76 T A 19: 12,120,011 S234C probably benign Het
Olfr796 A G 10: 129,608,160 V107A possibly damaging Het
Pank4 G A 4: 154,980,550 V769I probably benign Het
Ppp1r12a G A 10: 108,268,640 S911N probably benign Het
Prdx6b A G 2: 80,292,990 T48A probably damaging Het
Pttg1ip A G 10: 77,597,036 K166E probably damaging Het
Rabgap1l T C 1: 160,251,417 D9G Het
Rpl13a C T 7: 45,127,042 G69S probably benign Het
Rps6ka5 T A 12: 100,616,083 I177F probably damaging Het
Rttn C A 18: 89,060,479 A1343E probably damaging Het
Ryr2 C T 13: 11,560,653 V4820I possibly damaging Het
Slc12a7 A G 13: 73,790,772 I223V possibly damaging Het
Slc9a3 G A 13: 74,157,694 V277M probably damaging Het
Spata13 A T 14: 60,751,849 Y988F probably damaging Het
Spo11 A G 2: 172,992,071 I329V possibly damaging Het
Tcp11l2 A T 10: 84,587,134 D63V probably damaging Het
Tdrd3 G A 14: 87,506,593 W659* probably null Het
Thnsl2 T C 6: 71,141,327 D39G probably benign Het
Thumpd1 A T 7: 119,716,862 L288* probably null Het
Tram1l1 T C 3: 124,321,907 Y239H probably damaging Het
Usp38 T A 8: 80,981,972 E992D probably damaging Het
Usp45 A G 4: 21,784,790 T159A probably benign Het
Vmn1r218 C T 13: 23,136,660 T59I probably benign Het
Vmn2r70 T C 7: 85,565,291 I218V probably benign Het
Xpr1 T C 1: 155,307,742 I461V probably benign Het
Ydjc T C 16: 17,147,005 L8P probably damaging Het
Yme1l1 A T 2: 23,160,220 N21I possibly damaging Het
Zfhx4 T C 3: 5,390,366 L1140P probably benign Het
Other mutations in Pdgfrb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Pdgfrb APN 18 61068936 missense probably benign 0.20
IGL01396:Pdgfrb APN 18 61072664 missense probably damaging 1.00
IGL02377:Pdgfrb APN 18 61080332 missense probably damaging 1.00
IGL02435:Pdgfrb APN 18 61064926 critical splice donor site probably null
IGL03397:Pdgfrb APN 18 61079681 missense probably benign 0.28
R0021:Pdgfrb UTSW 18 61064926 critical splice donor site probably benign
R0021:Pdgfrb UTSW 18 61064926 critical splice donor site probably benign
R0087:Pdgfrb UTSW 18 61061513 missense probably damaging 1.00
R0119:Pdgfrb UTSW 18 61068852 missense probably benign 0.06
R0299:Pdgfrb UTSW 18 61068852 missense probably benign 0.06
R0532:Pdgfrb UTSW 18 61083265 missense probably damaging 1.00
R0570:Pdgfrb UTSW 18 61077703 missense probably benign 0.00
R0629:Pdgfrb UTSW 18 61078648 critical splice donor site probably null
R0650:Pdgfrb UTSW 18 61079708 missense probably benign 0.00
R0853:Pdgfrb UTSW 18 61080327 missense probably damaging 1.00
R1165:Pdgfrb UTSW 18 61064002 missense probably benign 0.01
R1342:Pdgfrb UTSW 18 61065880 nonsense probably null
R1740:Pdgfrb UTSW 18 61081833 missense possibly damaging 0.93
R1808:Pdgfrb UTSW 18 61068102 missense probably benign
R1864:Pdgfrb UTSW 18 61071717 missense probably benign 0.00
R1960:Pdgfrb UTSW 18 61065783 missense probably benign 0.05
R1961:Pdgfrb UTSW 18 61061505 missense possibly damaging 0.49
R1970:Pdgfrb UTSW 18 61066494 splice site probably benign
R2011:Pdgfrb UTSW 18 61061494 missense probably benign 0.01
R2012:Pdgfrb UTSW 18 61061494 missense probably benign 0.01
R2018:Pdgfrb UTSW 18 61083334 missense possibly damaging 0.84
R2153:Pdgfrb UTSW 18 61072756 missense probably damaging 1.00
R2497:Pdgfrb UTSW 18 61078628 missense possibly damaging 0.58
R2846:Pdgfrb UTSW 18 61064016 missense probably benign 0.00
R3776:Pdgfrb UTSW 18 61081920 missense probably benign 0.00
R3779:Pdgfrb UTSW 18 61072666 missense probably damaging 1.00
R3816:Pdgfrb UTSW 18 61078945 missense probably damaging 1.00
R3978:Pdgfrb UTSW 18 61073685 missense probably damaging 1.00
R4259:Pdgfrb UTSW 18 61077631 missense probably benign 0.00
R4261:Pdgfrb UTSW 18 61077631 missense probably benign 0.00
R4327:Pdgfrb UTSW 18 61071720 missense possibly damaging 0.83
R4329:Pdgfrb UTSW 18 61071720 missense possibly damaging 0.83
R4598:Pdgfrb UTSW 18 61068757 missense probably benign 0.03
R4668:Pdgfrb UTSW 18 61064113 missense probably damaging 1.00
R4761:Pdgfrb UTSW 18 61079700 missense probably damaging 1.00
R4787:Pdgfrb UTSW 18 61079687 missense probably damaging 1.00
R4828:Pdgfrb UTSW 18 61073243 missense probably damaging 0.98
R5030:Pdgfrb UTSW 18 61065135 missense probably benign 0.13
R5033:Pdgfrb UTSW 18 61077668 missense probably damaging 1.00
R5447:Pdgfrb UTSW 18 61068108 missense probably damaging 1.00
R6224:Pdgfrb UTSW 18 61081939 nonsense probably null
R6807:Pdgfrb UTSW 18 61078649 critical splice donor site probably null
R6858:Pdgfrb UTSW 18 61065147 missense probably benign 0.01
R7017:Pdgfrb UTSW 18 61081004 missense probably benign 0.00
R7089:Pdgfrb UTSW 18 61073243 missense probably damaging 1.00
R7174:Pdgfrb UTSW 18 61066515 missense probably benign
R7374:Pdgfrb UTSW 18 61071708 missense possibly damaging 0.64
R7496:Pdgfrb UTSW 18 61078932 missense possibly damaging 0.71
R7615:Pdgfrb UTSW 18 61064046 missense probably benign 0.00
R7691:Pdgfrb UTSW 18 61061268 missense probably benign 0.05
R7884:Pdgfrb UTSW 18 61072658 missense probably damaging 1.00
R8481:Pdgfrb UTSW 18 61065742 missense probably benign 0.03
R8735:Pdgfrb UTSW 18 61063977 missense probably benign 0.26
R8737:Pdgfrb UTSW 18 61081001 missense probably damaging 1.00
X0060:Pdgfrb UTSW 18 61081976 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATAACCTCTCTGAGCTGTG -3'
(R):5'- GACAGCTTGTGGCAGTGTAG -3'

Sequencing Primer
(F):5'- TGCTCCCCTTGGGGTACAG -3'
(R):5'- CCAGGCCAAGAGGGTTG -3'
Posted On2019-10-17