Incidental Mutation 'R7566:A830018L16Rik'
List [record 1 of 55] next >> last >|
ID585421
Institutional Source Beutler Lab
Gene Symbol A830018L16Rik
Ensembl Gene ENSMUSG00000057715
Gene NameRIKEN cDNA A830018L16 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R7566 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location11414105-11975901 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 11951028 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 420 (S420R)
Ref Sequence ENSEMBL: ENSMUSP00000117421 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048613] [ENSMUST00000137824] [ENSMUST00000179089]
Predicted Effect probably damaging
Transcript: ENSMUST00000048613
AA Change: S417R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000043857
Gene: ENSMUSG00000057715
AA Change: S417R

DomainStartEndE-ValueType
low complexity region 58 73 N/A INTRINSIC
low complexity region 213 223 N/A INTRINSIC
low complexity region 233 248 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000137824
AA Change: S420R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000117421
Gene: ENSMUSG00000057715
AA Change: S420R

DomainStartEndE-ValueType
low complexity region 58 73 N/A INTRINSIC
low complexity region 213 223 N/A INTRINSIC
low complexity region 233 248 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000179089
AA Change: S404R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is related to the cyclic AMP dependent protein kinase regulators. Naturally occurring mutations in this gene are associated with an increased risk for severe toxicities, such as diarrhea and neutropenia, in patients undergoing chemotherapeutic treatment. [provided by RefSeq, Mar 2017]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acat2 C T 17: 12,947,459 D219N probably damaging Het
Anapc10 G A 8: 79,719,679 R46Q possibly damaging Het
Ankub1 G A 3: 57,665,618 R228* probably null Het
Arhgap21 T C 2: 20,912,291 N91S probably benign Het
Arhgap32 T A 9: 32,250,722 V323D probably benign Het
Bcas1 C T 2: 170,370,449 probably null Het
C530008M17Rik G A 5: 76,866,275 probably null Het
Cd109 C T 9: 78,680,837 P716S probably damaging Het
Chd4 C T 6: 125,101,903 P267L possibly damaging Het
Cpne7 G T 8: 123,133,813 V502F probably damaging Het
Dlgap4 C T 2: 156,762,737 A921V probably benign Het
Faap24 G T 7: 35,393,040 R151S probably benign Het
Fam98a A G 17: 75,547,662 S51P probably damaging Het
Fbxl8 A G 8: 105,268,306 D150G possibly damaging Het
Fut10 A G 8: 31,259,922 K412R probably benign Het
G0s2 T C 1: 193,272,768 S3G probably benign Het
Gm1527 T C 3: 28,920,618 Y527H probably benign Het
Gsdmc3 T C 15: 63,861,661 K227R possibly damaging Het
Gtf2ird2 A G 5: 134,214,006 Y354C probably damaging Het
Hmcn2 T A 2: 31,454,857 N4685K probably damaging Het
Itgad A T 7: 128,192,107 Y717F probably benign Het
Kcnh5 C T 12: 75,114,392 W247* probably null Het
Kcnt1 C A 2: 25,916,036 S1212R probably benign Het
Kirrel A G 3: 87,088,484 V381A probably damaging Het
Loxl1 T A 9: 58,312,198 Q230L probably damaging Het
Magi1 T C 6: 93,678,327 E1446G probably benign Het
Man1a A G 10: 53,919,234 V550A possibly damaging Het
Mgat4d T C 8: 83,358,023 S132P probably damaging Het
Muc16 T A 9: 18,638,629 H5456L probably benign Het
Nhsl1 A G 10: 18,516,119 K207R probably damaging Het
Nlrp4a A C 7: 26,449,245 probably null Het
Nr6a1 T C 2: 38,731,073 M407V possibly damaging Het
Olfr1360 T G 13: 21,674,567 I126L possibly damaging Het
Olfr156 A G 4: 43,820,711 S217P probably damaging Het
Olfr30 G T 11: 58,455,663 F95L probably benign Het
Olfr776 T C 10: 129,261,600 I213T probably damaging Het
Ovgp1 A G 3: 105,974,310 probably benign Het
Ovol3 G T 7: 30,234,366 F110L probably damaging Het
Pcsk5 T C 19: 17,572,457 T724A probably benign Het
Phtf2 G T 5: 20,765,801 T653N probably damaging Het
Plch1 A T 3: 63,781,242 probably null Het
Prkce A T 17: 86,493,329 E391V probably benign Het
Prob1 A G 18: 35,654,985 V72A probably benign Het
Prrc2b C A 2: 32,194,390 P289Q probably benign Het
Ptbp3 A T 4: 59,514,280 N114K probably benign Het
Rho T A 6: 115,932,174 L57H probably damaging Het
Slc44a5 A C 3: 154,269,989 D679A probably damaging Het
Slit2 A T 5: 48,249,897 D898V probably damaging Het
Spag16 C T 1: 69,870,328 R195C probably damaging Het
Tmprss11a T G 5: 86,444,134 D60A possibly damaging Het
Ttn T A 2: 76,734,949 R28311S probably damaging Het
Wfikkn1 T C 17: 25,878,378 D324G probably damaging Het
Zan A C 5: 137,412,583 probably null Het
Zfp945 A T 17: 22,851,753 C412S possibly damaging Het
Other mutations in A830018L16Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:A830018L16Rik APN 1 11748054 missense probably damaging 0.98
IGL01916:A830018L16Rik APN 1 11748107 splice site probably benign
IGL02040:A830018L16Rik APN 1 11933598 intron probably benign
IGL02432:A830018L16Rik APN 1 11748079 missense probably damaging 1.00
IGL02693:A830018L16Rik APN 1 11596282 missense probably damaging 1.00
IGL02736:A830018L16Rik APN 1 11972051 missense probably benign 0.02
IGL03293:A830018L16Rik APN 1 11545151 splice site probably null
IGL02835:A830018L16Rik UTSW 1 11972055 missense possibly damaging 0.54
R1203:A830018L16Rik UTSW 1 11518594 missense probably damaging 1.00
R1216:A830018L16Rik UTSW 1 11798492 missense probably damaging 0.99
R1548:A830018L16Rik UTSW 1 11518594 missense probably damaging 1.00
R1644:A830018L16Rik UTSW 1 11414590 nonsense probably null
R1855:A830018L16Rik UTSW 1 11747971 missense probably damaging 1.00
R1858:A830018L16Rik UTSW 1 11974953 missense unknown
R2265:A830018L16Rik UTSW 1 11972104 critical splice donor site probably null
R2296:A830018L16Rik UTSW 1 11512051 missense possibly damaging 0.94
R2484:A830018L16Rik UTSW 1 11596302 missense probably damaging 1.00
R3730:A830018L16Rik UTSW 1 11545226 missense probably damaging 1.00
R3752:A830018L16Rik UTSW 1 11518680 missense probably damaging 1.00
R3861:A830018L16Rik UTSW 1 11588554 splice site probably benign
R4305:A830018L16Rik UTSW 1 11972076 nonsense probably null
R4306:A830018L16Rik UTSW 1 11972076 nonsense probably null
R4307:A830018L16Rik UTSW 1 11972076 nonsense probably null
R4558:A830018L16Rik UTSW 1 11972076 nonsense probably null
R4598:A830018L16Rik UTSW 1 11747964 critical splice acceptor site probably null
R4652:A830018L16Rik UTSW 1 11537342 intron probably benign
R5492:A830018L16Rik UTSW 1 11545207 missense probably damaging 0.99
R5493:A830018L16Rik UTSW 1 11545207 missense probably damaging 0.99
R5802:A830018L16Rik UTSW 1 11950964 missense probably damaging 1.00
R6007:A830018L16Rik UTSW 1 11511916 critical splice acceptor site probably null
R6082:A830018L16Rik UTSW 1 11798528 missense probably benign 0.04
R6376:A830018L16Rik UTSW 1 11798494 missense probably damaging 0.98
R6453:A830018L16Rik UTSW 1 11798558 missense possibly damaging 0.91
R6757:A830018L16Rik UTSW 1 11596334 makesense probably null
R6833:A830018L16Rik UTSW 1 11588509 missense probably damaging 1.00
R7163:A830018L16Rik UTSW 1 11414624 missense probably damaging 0.96
R7272:A830018L16Rik UTSW 1 11588471 missense probably damaging 0.97
R7665:A830018L16Rik UTSW 1 11972099 missense probably damaging 0.96
R8004:A830018L16Rik UTSW 1 11951062 splice site probably benign
Z1176:A830018L16Rik UTSW 1 11518625 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GAACTACCCTTGGCACATGC -3'
(R):5'- TTAGCTGGACATTCCTTCGTTG -3'

Sequencing Primer
(F):5'- GTTTACCACTTAGAACACAGCTGTC -3'
(R):5'- GGACATTCCTTCGTTGTTATCAAG -3'
Posted On2019-10-17