Incidental Mutation 'R7566:Nr6a1'
ID585428
Institutional Source Beutler Lab
Gene Symbol Nr6a1
Ensembl Gene ENSMUSG00000063972
Gene Namenuclear receptor subfamily 6, group A, member 1
Synonyms1700113M01Rik, Gcnf, NCNF
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7566 (G1)
Quality Score218.009
Status Validated
Chromosome2
Chromosomal Location38723370-38927688 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38731073 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 407 (M407V)
Ref Sequence ENSEMBL: ENSMUSP00000075624 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076275] [ENSMUST00000112877] [ENSMUST00000168098]
Predicted Effect possibly damaging
Transcript: ENSMUST00000076275
AA Change: M407V

PolyPhen 2 Score 0.770 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000075624
Gene: ENSMUSG00000063972
AA Change: M407V

DomainStartEndE-ValueType
low complexity region 23 31 N/A INTRINSIC
ZnF_C4 72 143 9.35e-36 SMART
low complexity region 202 216 N/A INTRINSIC
HOLI 304 466 3.19e-29 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112877
AA Change: M407V

PolyPhen 2 Score 0.770 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000108498
Gene: ENSMUSG00000063972
AA Change: M407V

DomainStartEndE-ValueType
low complexity region 23 31 N/A INTRINSIC
ZnF_C4 72 143 9.35e-36 SMART
low complexity region 202 216 N/A INTRINSIC
HOLI 304 466 3.19e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168098
AA Change: M350V

PolyPhen 2 Score 0.377 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000126009
Gene: ENSMUSG00000063972
AA Change: M350V

DomainStartEndE-ValueType
ZnF_C4 15 86 9.35e-36 SMART
low complexity region 145 159 N/A INTRINSIC
HOLI 247 409 3.19e-29 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an orphan nuclear receptor which is a member of the nuclear hormone receptor family. Its expression pattern suggests that it may be involved in neurogenesis and germ cell development. The protein can homodimerize and bind DNA, but in vivo targets have not been identified. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygotes for targeted null mutations have cardiovascular abnormalities, defective trunk development, impaired somite formation, failure to turn, open neural tube and hindgut, protrusion of the tailbud outside the yolk sac and die by embryonic day 10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik T G 1: 11,951,028 S420R probably damaging Het
Acat2 C T 17: 12,947,459 D219N probably damaging Het
Anapc10 G A 8: 79,719,679 R46Q possibly damaging Het
Ankub1 G A 3: 57,665,618 R228* probably null Het
Arhgap21 T C 2: 20,912,291 N91S probably benign Het
Arhgap32 T A 9: 32,250,722 V323D probably benign Het
Bcas1 C T 2: 170,370,449 probably null Het
C530008M17Rik G A 5: 76,866,275 probably null Het
Cd109 C T 9: 78,680,837 P716S probably damaging Het
Chd4 C T 6: 125,101,903 P267L possibly damaging Het
Cpne7 G T 8: 123,133,813 V502F probably damaging Het
Dlgap4 C T 2: 156,762,737 A921V probably benign Het
Faap24 G T 7: 35,393,040 R151S probably benign Het
Fam98a A G 17: 75,547,662 S51P probably damaging Het
Fbxl8 A G 8: 105,268,306 D150G possibly damaging Het
Fut10 A G 8: 31,259,922 K412R probably benign Het
G0s2 T C 1: 193,272,768 S3G probably benign Het
Gm1527 T C 3: 28,920,618 Y527H probably benign Het
Gsdmc3 T C 15: 63,861,661 K227R possibly damaging Het
Gtf2ird2 A G 5: 134,214,006 Y354C probably damaging Het
Hmcn2 T A 2: 31,454,857 N4685K probably damaging Het
Itgad A T 7: 128,192,107 Y717F probably benign Het
Kcnh5 C T 12: 75,114,392 W247* probably null Het
Kcnt1 C A 2: 25,916,036 S1212R probably benign Het
Kirrel A G 3: 87,088,484 V381A probably damaging Het
Loxl1 T A 9: 58,312,198 Q230L probably damaging Het
Magi1 T C 6: 93,678,327 E1446G probably benign Het
Man1a A G 10: 53,919,234 V550A possibly damaging Het
Mgat4d T C 8: 83,358,023 S132P probably damaging Het
Muc16 T A 9: 18,638,629 H5456L probably benign Het
Nhsl1 A G 10: 18,516,119 K207R probably damaging Het
Nlrp4a A C 7: 26,449,245 probably null Het
Olfr1360 T G 13: 21,674,567 I126L possibly damaging Het
Olfr156 A G 4: 43,820,711 S217P probably damaging Het
Olfr30 G T 11: 58,455,663 F95L probably benign Het
Olfr776 T C 10: 129,261,600 I213T probably damaging Het
Ovgp1 A G 3: 105,974,310 probably benign Het
Ovol3 G T 7: 30,234,366 F110L probably damaging Het
Pcsk5 T C 19: 17,572,457 T724A probably benign Het
Phtf2 G T 5: 20,765,801 T653N probably damaging Het
Plch1 A T 3: 63,781,242 probably null Het
Prkce A T 17: 86,493,329 E391V probably benign Het
Prob1 A G 18: 35,654,985 V72A probably benign Het
Prrc2b C A 2: 32,194,390 P289Q probably benign Het
Ptbp3 A T 4: 59,514,280 N114K probably benign Het
Rho T A 6: 115,932,174 L57H probably damaging Het
Slc44a5 A C 3: 154,269,989 D679A probably damaging Het
Slit2 A T 5: 48,249,897 D898V probably damaging Het
Spag16 C T 1: 69,870,328 R195C probably damaging Het
Tmprss11a T G 5: 86,444,134 D60A possibly damaging Het
Ttn T A 2: 76,734,949 R28311S probably damaging Het
Wfikkn1 T C 17: 25,878,378 D324G probably damaging Het
Zan A C 5: 137,412,583 probably null Het
Zfp945 A T 17: 22,851,753 C412S possibly damaging Het
Other mutations in Nr6a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01566:Nr6a1 APN 2 38727889 missense probably benign 0.06
IGL02245:Nr6a1 APN 2 38740553 missense probably benign 0.04
IGL03195:Nr6a1 APN 2 38742936 missense probably damaging 1.00
R0270:Nr6a1 UTSW 2 38739020 missense possibly damaging 0.75
R0909:Nr6a1 UTSW 2 38885206 missense probably benign 0.11
R1737:Nr6a1 UTSW 2 38738943 missense probably benign 0.04
R5918:Nr6a1 UTSW 2 38739091 missense probably damaging 1.00
R6210:Nr6a1 UTSW 2 38729497 missense probably damaging 0.99
R6311:Nr6a1 UTSW 2 38739071 missense possibly damaging 0.69
R6861:Nr6a1 UTSW 2 38740585 missense possibly damaging 0.71
R6978:Nr6a1 UTSW 2 38872619 missense probably benign
R8177:Nr6a1 UTSW 2 38729498 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TACCAGGGTGATGACTAGGG -3'
(R):5'- GCCATACAAAGCATGGAGTTC -3'

Sequencing Primer
(F):5'- ACTAGGGGGAGTACAGGTCTTCC -3'
(R):5'- CATACAAAGCATGGAGTTCCCTGTG -3'
Posted On2019-10-17