Incidental Mutation 'R7566:Dlgap4'
List |< first << previous [record 12 of 55] next >> last >|
ID585430
Institutional Source Beutler Lab
Gene Symbol Dlgap4
Ensembl Gene ENSMUSG00000061689
Gene NameDLG associated protein 4
SynonymsSAP90/PSD-95-associated protein 4, WBP16, PSD-95/SAP90 binding protein 4, Sapap4, DAP4
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.267) question?
Stock #R7566 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location156613705-156764363 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 156762737 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 921 (A921V)
Ref Sequence ENSEMBL: ENSMUSP00000105196 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000094] [ENSMUST00000070782] [ENSMUST00000099145] [ENSMUST00000109566] [ENSMUST00000109567] [ENSMUST00000109568] [ENSMUST00000131157] [ENSMUST00000169464] [ENSMUST00000171030]
Predicted Effect probably benign
Transcript: ENSMUST00000000094
SMART Domains Protein: ENSMUSP00000000094
Gene: ENSMUSG00000061689

DomainStartEndE-ValueType
Pfam:GKAP 3 232 2.4e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000070782
AA Change: A935V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000068745
Gene: ENSMUSG00000061689
AA Change: A935V

DomainStartEndE-ValueType
low complexity region 162 177 N/A INTRINSIC
low complexity region 253 277 N/A INTRINSIC
low complexity region 373 390 N/A INTRINSIC
low complexity region 480 497 N/A INTRINSIC
low complexity region 527 554 N/A INTRINSIC
low complexity region 558 572 N/A INTRINSIC
low complexity region 600 620 N/A INTRINSIC
low complexity region 628 637 N/A INTRINSIC
Pfam:GKAP 638 989 1.2e-132 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099145
AA Change: A399V

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000096749
Gene: ENSMUSG00000061689
AA Change: A399V

DomainStartEndE-ValueType
low complexity region 19 33 N/A INTRINSIC
low complexity region 61 81 N/A INTRINSIC
low complexity region 89 98 N/A INTRINSIC
Pfam:GKAP 114 453 2.4e-126 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109566
AA Change: A231V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000105194
Gene: ENSMUSG00000061689
AA Change: A231V

DomainStartEndE-ValueType
Pfam:GKAP 1 285 2e-114 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109567
AA Change: A935V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105195
Gene: ENSMUSG00000061689
AA Change: A935V

DomainStartEndE-ValueType
low complexity region 162 177 N/A INTRINSIC
low complexity region 253 277 N/A INTRINSIC
low complexity region 373 390 N/A INTRINSIC
low complexity region 480 497 N/A INTRINSIC
low complexity region 527 554 N/A INTRINSIC
low complexity region 558 572 N/A INTRINSIC
low complexity region 600 620 N/A INTRINSIC
Pfam:GKAP 636 989 4.4e-116 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109568
AA Change: A921V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000105196
Gene: ENSMUSG00000061689
AA Change: A921V

DomainStartEndE-ValueType
low complexity region 162 177 N/A INTRINSIC
low complexity region 253 277 N/A INTRINSIC
low complexity region 373 390 N/A INTRINSIC
low complexity region 463 480 N/A INTRINSIC
low complexity region 510 537 N/A INTRINSIC
low complexity region 541 555 N/A INTRINSIC
low complexity region 583 603 N/A INTRINSIC
low complexity region 611 620 N/A INTRINSIC
Pfam:GKAP 636 975 5.6e-126 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131157
SMART Domains Protein: ENSMUSP00000134941
Gene: ENSMUSG00000061689

DomainStartEndE-ValueType
Pfam:GKAP 1 110 2.2e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169464
AA Change: A938V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000126980
Gene: ENSMUSG00000061689
AA Change: A938V

DomainStartEndE-ValueType
low complexity region 162 177 N/A INTRINSIC
low complexity region 253 277 N/A INTRINSIC
low complexity region 373 390 N/A INTRINSIC
low complexity region 480 497 N/A INTRINSIC
low complexity region 527 554 N/A INTRINSIC
low complexity region 558 572 N/A INTRINSIC
low complexity region 600 620 N/A INTRINSIC
low complexity region 628 637 N/A INTRINSIC
Pfam:GKAP 660 992 1.5e-148 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171030
AA Change: A231V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000129756
Gene: ENSMUSG00000061689
AA Change: A231V

DomainStartEndE-ValueType
Pfam:GKAP 1 266 8.7e-103 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: This gene encodes a membrane-associated guanylate kinase found at the postsynaptic density in neuronal cells. The encoded protein may play a role in synapse organization and neuronal signalling. Alternatively spliced transcript variants encoding multiple isoforms have been found for this gene. [provided by RefSeq, Mar 2013]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik T G 1: 11,951,028 S420R probably damaging Het
Acat2 C T 17: 12,947,459 D219N probably damaging Het
Anapc10 G A 8: 79,719,679 R46Q possibly damaging Het
Ankub1 G A 3: 57,665,618 R228* probably null Het
Arhgap21 T C 2: 20,912,291 N91S probably benign Het
Arhgap32 T A 9: 32,250,722 V323D probably benign Het
Bcas1 C T 2: 170,370,449 probably null Het
C530008M17Rik G A 5: 76,866,275 probably null Het
Cd109 C T 9: 78,680,837 P716S probably damaging Het
Chd4 C T 6: 125,101,903 P267L possibly damaging Het
Cpne7 G T 8: 123,133,813 V502F probably damaging Het
Faap24 G T 7: 35,393,040 R151S probably benign Het
Fam98a A G 17: 75,547,662 S51P probably damaging Het
Fbxl8 A G 8: 105,268,306 D150G possibly damaging Het
Fut10 A G 8: 31,259,922 K412R probably benign Het
G0s2 T C 1: 193,272,768 S3G probably benign Het
Gm1527 T C 3: 28,920,618 Y527H probably benign Het
Gsdmc3 T C 15: 63,861,661 K227R possibly damaging Het
Gtf2ird2 A G 5: 134,214,006 Y354C probably damaging Het
Hmcn2 T A 2: 31,454,857 N4685K probably damaging Het
Itgad A T 7: 128,192,107 Y717F probably benign Het
Kcnh5 C T 12: 75,114,392 W247* probably null Het
Kcnt1 C A 2: 25,916,036 S1212R probably benign Het
Kirrel A G 3: 87,088,484 V381A probably damaging Het
Loxl1 T A 9: 58,312,198 Q230L probably damaging Het
Magi1 T C 6: 93,678,327 E1446G probably benign Het
Man1a A G 10: 53,919,234 V550A possibly damaging Het
Mgat4d T C 8: 83,358,023 S132P probably damaging Het
Muc16 T A 9: 18,638,629 H5456L probably benign Het
Nhsl1 A G 10: 18,516,119 K207R probably damaging Het
Nlrp4a A C 7: 26,449,245 probably null Het
Nr6a1 T C 2: 38,731,073 M407V possibly damaging Het
Olfr1360 T G 13: 21,674,567 I126L possibly damaging Het
Olfr156 A G 4: 43,820,711 S217P probably damaging Het
Olfr30 G T 11: 58,455,663 F95L probably benign Het
Olfr776 T C 10: 129,261,600 I213T probably damaging Het
Ovgp1 A G 3: 105,974,310 probably benign Het
Ovol3 G T 7: 30,234,366 F110L probably damaging Het
Pcsk5 T C 19: 17,572,457 T724A probably benign Het
Phtf2 G T 5: 20,765,801 T653N probably damaging Het
Plch1 A T 3: 63,781,242 probably null Het
Prkce A T 17: 86,493,329 E391V probably benign Het
Prob1 A G 18: 35,654,985 V72A probably benign Het
Prrc2b C A 2: 32,194,390 P289Q probably benign Het
Ptbp3 A T 4: 59,514,280 N114K probably benign Het
Rho T A 6: 115,932,174 L57H probably damaging Het
Slc44a5 A C 3: 154,269,989 D679A probably damaging Het
Slit2 A T 5: 48,249,897 D898V probably damaging Het
Spag16 C T 1: 69,870,328 R195C probably damaging Het
Tmprss11a T G 5: 86,444,134 D60A possibly damaging Het
Ttn T A 2: 76,734,949 R28311S probably damaging Het
Wfikkn1 T C 17: 25,878,378 D324G probably damaging Het
Zan A C 5: 137,412,583 probably null Het
Zfp945 A T 17: 22,851,753 C412S possibly damaging Het
Other mutations in Dlgap4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02164:Dlgap4 APN 2 156711139 missense probably damaging 1.00
IGL02732:Dlgap4 APN 2 156749323 missense probably benign 0.30
IGL02868:Dlgap4 APN 2 156700896 missense probably damaging 1.00
IGL03169:Dlgap4 APN 2 156711018 splice site probably null
IGL03220:Dlgap4 APN 2 156704626 missense probably damaging 1.00
E0374:Dlgap4 UTSW 2 156761843 missense probably damaging 1.00
R0413:Dlgap4 UTSW 2 156762826 missense probably damaging 1.00
R0573:Dlgap4 UTSW 2 156746191 missense probably benign 0.32
R0645:Dlgap4 UTSW 2 156761879 missense probably damaging 1.00
R0893:Dlgap4 UTSW 2 156745978 nonsense probably null
R1472:Dlgap4 UTSW 2 156760901 nonsense probably null
R1620:Dlgap4 UTSW 2 156749136 nonsense probably null
R1636:Dlgap4 UTSW 2 156746077 nonsense probably null
R2078:Dlgap4 UTSW 2 156762826 missense probably damaging 1.00
R2173:Dlgap4 UTSW 2 156762812 missense probably damaging 1.00
R2264:Dlgap4 UTSW 2 156701463 missense probably benign 0.00
R2348:Dlgap4 UTSW 2 156701206 missense possibly damaging 0.80
R3608:Dlgap4 UTSW 2 156748412 intron probably benign
R3872:Dlgap4 UTSW 2 156749347 missense probably benign 0.21
R3873:Dlgap4 UTSW 2 156749347 missense probably benign 0.21
R3874:Dlgap4 UTSW 2 156749347 missense probably benign 0.21
R3897:Dlgap4 UTSW 2 156746069 missense probably damaging 1.00
R5068:Dlgap4 UTSW 2 156707111 missense probably benign
R5286:Dlgap4 UTSW 2 156745919 missense probably damaging 1.00
R5302:Dlgap4 UTSW 2 156760898 missense probably damaging 1.00
R5568:Dlgap4 UTSW 2 156762901 makesense probably null
R5691:Dlgap4 UTSW 2 156704470 missense probably benign
R5741:Dlgap4 UTSW 2 156711048 missense probably damaging 1.00
R5917:Dlgap4 UTSW 2 156704540 missense probably damaging 1.00
R6140:Dlgap4 UTSW 2 156762729 unclassified probably null
R6992:Dlgap4 UTSW 2 156748940 splice site probably null
R7082:Dlgap4 UTSW 2 156748422 critical splice donor site probably null
R7698:Dlgap4 UTSW 2 156749095 nonsense probably null
R7767:Dlgap4 UTSW 2 156746053 missense probably damaging 1.00
R7853:Dlgap4 UTSW 2 156705882 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCAGTCTGTTGTGGAGACTC -3'
(R):5'- ACGCTGTTCCATTTGCATTG -3'

Sequencing Primer
(F):5'- CTGTTGTGGAGACTCGGGGTG -3'
(R):5'- AAATTGAGTGCTTTCTCCTTCACGG -3'
Posted On2019-10-17