Incidental Mutation 'R7566:Bcas1'
List |< first << previous [record 7 of 55] next >> last >|
ID585431
Institutional Source Beutler Lab
Gene Symbol Bcas1
Ensembl Gene ENSMUSG00000013523
Gene Namebreast carcinoma amplified sequence 1
Synonyms9030223A09Rik, 2210416M21Rik, NABC1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7566 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location170346991-170427845 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 170370449 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000013667 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013667] [ENSMUST00000068137] [ENSMUST00000109152]
Predicted Effect probably null
Transcript: ENSMUST00000013667
SMART Domains Protein: ENSMUSP00000013667
Gene: ENSMUSG00000013523

DomainStartEndE-ValueType
low complexity region 174 187 N/A INTRINSIC
low complexity region 299 315 N/A INTRINSIC
low complexity region 391 398 N/A INTRINSIC
low complexity region 542 554 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000068137
SMART Domains Protein: ENSMUSP00000069437
Gene: ENSMUSG00000013523

DomainStartEndE-ValueType
low complexity region 164 177 N/A INTRINSIC
low complexity region 289 302 N/A INTRINSIC
low complexity region 335 342 N/A INTRINSIC
low complexity region 486 498 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000109152
SMART Domains Protein: ENSMUSP00000104780
Gene: ENSMUSG00000013523

DomainStartEndE-ValueType
low complexity region 174 187 N/A INTRINSIC
low complexity region 299 312 N/A INTRINSIC
low complexity region 345 352 N/A INTRINSIC
low complexity region 496 508 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154650
SMART Domains Protein: ENSMUSP00000122298
Gene: ENSMUSG00000013523

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
low complexity region 136 152 N/A INTRINSIC
low complexity region 228 235 N/A INTRINSIC
low complexity region 288 300 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene resides in a region at 20q13 which is amplified in a variety of tumor types and associated with more aggressive tumor phenotypes. Among the genes identified from this region, it was found to be highly expressed in three amplified breast cancer cell lines and in one breast tumor without amplification at 20q13.2. However, this gene is not in the common region of maximal amplification and its expression was not detected in the breast cancer cell line MCF7, in which this region is highly amplified. Although not consistently expressed, this gene is a candidate oncogene. [provided by RefSeq, Apr 2016]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik T G 1: 11,951,028 S420R probably damaging Het
Acat2 C T 17: 12,947,459 D219N probably damaging Het
Anapc10 G A 8: 79,719,679 R46Q possibly damaging Het
Ankub1 G A 3: 57,665,618 R228* probably null Het
Arhgap21 T C 2: 20,912,291 N91S probably benign Het
Arhgap32 T A 9: 32,250,722 V323D probably benign Het
C530008M17Rik G A 5: 76,866,275 probably null Het
Cd109 C T 9: 78,680,837 P716S probably damaging Het
Chd4 C T 6: 125,101,903 P267L possibly damaging Het
Cpne7 G T 8: 123,133,813 V502F probably damaging Het
Dlgap4 C T 2: 156,762,737 A921V probably benign Het
Faap24 G T 7: 35,393,040 R151S probably benign Het
Fam98a A G 17: 75,547,662 S51P probably damaging Het
Fbxl8 A G 8: 105,268,306 D150G possibly damaging Het
Fut10 A G 8: 31,259,922 K412R probably benign Het
G0s2 T C 1: 193,272,768 S3G probably benign Het
Gm1527 T C 3: 28,920,618 Y527H probably benign Het
Gsdmc3 T C 15: 63,861,661 K227R possibly damaging Het
Gtf2ird2 A G 5: 134,214,006 Y354C probably damaging Het
Hmcn2 T A 2: 31,454,857 N4685K probably damaging Het
Itgad A T 7: 128,192,107 Y717F probably benign Het
Kcnh5 C T 12: 75,114,392 W247* probably null Het
Kcnt1 C A 2: 25,916,036 S1212R probably benign Het
Kirrel A G 3: 87,088,484 V381A probably damaging Het
Loxl1 T A 9: 58,312,198 Q230L probably damaging Het
Magi1 T C 6: 93,678,327 E1446G probably benign Het
Man1a A G 10: 53,919,234 V550A possibly damaging Het
Mgat4d T C 8: 83,358,023 S132P probably damaging Het
Muc16 T A 9: 18,638,629 H5456L probably benign Het
Nhsl1 A G 10: 18,516,119 K207R probably damaging Het
Nlrp4a A C 7: 26,449,245 probably null Het
Nr6a1 T C 2: 38,731,073 M407V possibly damaging Het
Olfr1360 T G 13: 21,674,567 I126L possibly damaging Het
Olfr156 A G 4: 43,820,711 S217P probably damaging Het
Olfr30 G T 11: 58,455,663 F95L probably benign Het
Olfr776 T C 10: 129,261,600 I213T probably damaging Het
Ovgp1 A G 3: 105,974,310 probably benign Het
Ovol3 G T 7: 30,234,366 F110L probably damaging Het
Pcsk5 T C 19: 17,572,457 T724A probably benign Het
Phtf2 G T 5: 20,765,801 T653N probably damaging Het
Plch1 A T 3: 63,781,242 probably null Het
Prkce A T 17: 86,493,329 E391V probably benign Het
Prob1 A G 18: 35,654,985 V72A probably benign Het
Prrc2b C A 2: 32,194,390 P289Q probably benign Het
Ptbp3 A T 4: 59,514,280 N114K probably benign Het
Rho T A 6: 115,932,174 L57H probably damaging Het
Slc44a5 A C 3: 154,269,989 D679A probably damaging Het
Slit2 A T 5: 48,249,897 D898V probably damaging Het
Spag16 C T 1: 69,870,328 R195C probably damaging Het
Tmprss11a T G 5: 86,444,134 D60A possibly damaging Het
Ttn T A 2: 76,734,949 R28311S probably damaging Het
Wfikkn1 T C 17: 25,878,378 D324G probably damaging Het
Zan A C 5: 137,412,583 probably null Het
Zfp945 A T 17: 22,851,753 C412S possibly damaging Het
Other mutations in Bcas1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01647:Bcas1 APN 2 170349252 missense probably damaging 0.99
IGL01714:Bcas1 APN 2 170384182 splice site probably benign
IGL02267:Bcas1 APN 2 170378788 nonsense probably null
IGL02486:Bcas1 APN 2 170406398 missense probably damaging 1.00
IGL03328:Bcas1 APN 2 170366396 nonsense probably null
R0335:Bcas1 UTSW 2 170418681 missense probably damaging 0.97
R1458:Bcas1 UTSW 2 170387951 missense probably damaging 1.00
R1463:Bcas1 UTSW 2 170418664 missense probably benign 0.07
R1467:Bcas1 UTSW 2 170387932 missense possibly damaging 0.92
R1467:Bcas1 UTSW 2 170387932 missense possibly damaging 0.92
R1507:Bcas1 UTSW 2 170366428 missense probably damaging 0.99
R1645:Bcas1 UTSW 2 170387167 missense probably damaging 1.00
R1654:Bcas1 UTSW 2 170349246 missense probably damaging 1.00
R1911:Bcas1 UTSW 2 170387943 missense probably damaging 1.00
R1990:Bcas1 UTSW 2 170370477 missense possibly damaging 0.83
R2017:Bcas1 UTSW 2 170348161 splice site probably null
R4119:Bcas1 UTSW 2 170378815 missense probably benign 0.02
R4181:Bcas1 UTSW 2 170418627 missense probably benign 0.26
R4302:Bcas1 UTSW 2 170418627 missense probably benign 0.26
R4497:Bcas1 UTSW 2 170406821 missense probably damaging 1.00
R4670:Bcas1 UTSW 2 170384325 missense probably damaging 0.99
R4671:Bcas1 UTSW 2 170384325 missense probably damaging 0.99
R4914:Bcas1 UTSW 2 170378886 missense probably damaging 1.00
R4915:Bcas1 UTSW 2 170378886 missense probably damaging 1.00
R4917:Bcas1 UTSW 2 170378886 missense probably damaging 1.00
R4918:Bcas1 UTSW 2 170378886 missense probably damaging 1.00
R5155:Bcas1 UTSW 2 170418618 missense probably damaging 0.98
R5354:Bcas1 UTSW 2 170349396 missense possibly damaging 0.94
R5686:Bcas1 UTSW 2 170406810 missense probably benign 0.03
R7736:Bcas1 UTSW 2 170387164 missense possibly damaging 0.89
R7816:Bcas1 UTSW 2 170406427 missense probably benign 0.11
R7850:Bcas1 UTSW 2 170348103 missense probably damaging 1.00
R8078:Bcas1 UTSW 2 170418612 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- GTGCTGACATTGCTCTTACTG -3'
(R):5'- AACTGCCCTACTGGTCTGGTAG -3'

Sequencing Primer
(F):5'- GTGCTGACATTGCTCTTACTGTTTTC -3'
(R):5'- TGGTAGACCAGATAGCCCAATTTAGC -3'
Posted On2019-10-17