Incidental Mutation 'R7566:Gm1527'
ID585432
Institutional Source Beutler Lab
Gene Symbol Gm1527
Ensembl Gene ENSMUSG00000074655
Gene Namepredicted gene 1527
SynonymsLOC385263
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R7566 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location28892617-28926724 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 28920618 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 527 (Y527H)
Ref Sequence ENSEMBL: ENSMUSP00000096773 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099170]
Predicted Effect probably benign
Transcript: ENSMUST00000099170
AA Change: Y527H

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000096773
Gene: ENSMUSG00000074655
AA Change: Y527H

DomainStartEndE-ValueType
PH 16 119 2.37e-6 SMART
Pfam:RA 125 214 1.7e-8 PFAM
RhoGAP 300 471 2.8e-29 SMART
transmembrane domain 623 645 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik T G 1: 11,951,028 S420R probably damaging Het
Acat2 C T 17: 12,947,459 D219N probably damaging Het
Anapc10 G A 8: 79,719,679 R46Q possibly damaging Het
Ankub1 G A 3: 57,665,618 R228* probably null Het
Arhgap21 T C 2: 20,912,291 N91S probably benign Het
Arhgap32 T A 9: 32,250,722 V323D probably benign Het
Bcas1 C T 2: 170,370,449 probably null Het
C530008M17Rik G A 5: 76,866,275 probably null Het
Cd109 C T 9: 78,680,837 P716S probably damaging Het
Chd4 C T 6: 125,101,903 P267L possibly damaging Het
Cpne7 G T 8: 123,133,813 V502F probably damaging Het
Dlgap4 C T 2: 156,762,737 A921V probably benign Het
Faap24 G T 7: 35,393,040 R151S probably benign Het
Fam98a A G 17: 75,547,662 S51P probably damaging Het
Fbxl8 A G 8: 105,268,306 D150G possibly damaging Het
Fut10 A G 8: 31,259,922 K412R probably benign Het
G0s2 T C 1: 193,272,768 S3G probably benign Het
Gsdmc3 T C 15: 63,861,661 K227R possibly damaging Het
Gtf2ird2 A G 5: 134,214,006 Y354C probably damaging Het
Hmcn2 T A 2: 31,454,857 N4685K probably damaging Het
Itgad A T 7: 128,192,107 Y717F probably benign Het
Kcnh5 C T 12: 75,114,392 W247* probably null Het
Kcnt1 C A 2: 25,916,036 S1212R probably benign Het
Kirrel A G 3: 87,088,484 V381A probably damaging Het
Loxl1 T A 9: 58,312,198 Q230L probably damaging Het
Magi1 T C 6: 93,678,327 E1446G probably benign Het
Man1a A G 10: 53,919,234 V550A possibly damaging Het
Mgat4d T C 8: 83,358,023 S132P probably damaging Het
Muc16 T A 9: 18,638,629 H5456L probably benign Het
Nhsl1 A G 10: 18,516,119 K207R probably damaging Het
Nlrp4a A C 7: 26,449,245 probably null Het
Nr6a1 T C 2: 38,731,073 M407V possibly damaging Het
Olfr1360 T G 13: 21,674,567 I126L possibly damaging Het
Olfr156 A G 4: 43,820,711 S217P probably damaging Het
Olfr30 G T 11: 58,455,663 F95L probably benign Het
Olfr776 T C 10: 129,261,600 I213T probably damaging Het
Ovgp1 A G 3: 105,974,310 probably benign Het
Ovol3 G T 7: 30,234,366 F110L probably damaging Het
Pcsk5 T C 19: 17,572,457 T724A probably benign Het
Phtf2 G T 5: 20,765,801 T653N probably damaging Het
Plch1 A T 3: 63,781,242 probably null Het
Prkce A T 17: 86,493,329 E391V probably benign Het
Prob1 A G 18: 35,654,985 V72A probably benign Het
Prrc2b C A 2: 32,194,390 P289Q probably benign Het
Ptbp3 A T 4: 59,514,280 N114K probably benign Het
Rho T A 6: 115,932,174 L57H probably damaging Het
Slc44a5 A C 3: 154,269,989 D679A probably damaging Het
Slit2 A T 5: 48,249,897 D898V probably damaging Het
Spag16 C T 1: 69,870,328 R195C probably damaging Het
Tmprss11a T G 5: 86,444,134 D60A possibly damaging Het
Ttn T A 2: 76,734,949 R28311S probably damaging Het
Wfikkn1 T C 17: 25,878,378 D324G probably damaging Het
Zan A C 5: 137,412,583 probably null Het
Zfp945 A T 17: 22,851,753 C412S possibly damaging Het
Other mutations in Gm1527
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01518:Gm1527 APN 3 28895588 utr 5 prime probably benign
IGL02069:Gm1527 APN 3 28926614 missense possibly damaging 0.53
IGL02794:Gm1527 APN 3 28895680 missense unknown
IGL03285:Gm1527 APN 3 28920417 missense probably damaging 1.00
PIT4403001:Gm1527 UTSW 3 28917985 missense possibly damaging 0.82
R0316:Gm1527 UTSW 3 28915774 missense probably damaging 1.00
R0487:Gm1527 UTSW 3 28926679 missense probably benign 0.00
R1411:Gm1527 UTSW 3 28914483 missense probably benign 0.04
R1458:Gm1527 UTSW 3 28918050 missense possibly damaging 0.52
R1470:Gm1527 UTSW 3 28915268 missense possibly damaging 0.82
R1470:Gm1527 UTSW 3 28915268 missense possibly damaging 0.82
R1476:Gm1527 UTSW 3 28926556 missense probably benign 0.19
R1523:Gm1527 UTSW 3 28920418 missense probably damaging 1.00
R1613:Gm1527 UTSW 3 28898853 critical splice donor site probably null
R1649:Gm1527 UTSW 3 28898731 missense probably damaging 1.00
R1722:Gm1527 UTSW 3 28921634 missense probably benign 0.10
R1760:Gm1527 UTSW 3 28895550 splice site probably benign
R1857:Gm1527 UTSW 3 28903390 missense probably damaging 0.99
R1981:Gm1527 UTSW 3 28915835 critical splice donor site probably null
R2063:Gm1527 UTSW 3 28926647 missense probably benign 0.04
R2080:Gm1527 UTSW 3 28926661 missense probably benign 0.01
R2115:Gm1527 UTSW 3 28917949 missense probably benign 0.00
R2440:Gm1527 UTSW 3 28895615 missense probably damaging 0.98
R3799:Gm1527 UTSW 3 28926596 missense possibly damaging 0.53
R4012:Gm1527 UTSW 3 28898820 missense probably benign 0.04
R4132:Gm1527 UTSW 3 28920630 missense probably benign 0.37
R4234:Gm1527 UTSW 3 28914366 missense probably damaging 1.00
R4406:Gm1527 UTSW 3 28895725 missense possibly damaging 0.81
R4528:Gm1527 UTSW 3 28914393 missense probably damaging 0.99
R4567:Gm1527 UTSW 3 28914407 missense probably damaging 0.99
R4795:Gm1527 UTSW 3 28920663 missense possibly damaging 0.56
R4796:Gm1527 UTSW 3 28920663 missense possibly damaging 0.56
R5127:Gm1527 UTSW 3 28903418 missense probably damaging 1.00
R5774:Gm1527 UTSW 3 28918090 missense probably benign 0.22
R5890:Gm1527 UTSW 3 28915395 missense probably benign 0.03
R6024:Gm1527 UTSW 3 28920603 missense probably benign 0.10
R7092:Gm1527 UTSW 3 28914547 critical splice donor site probably null
R7128:Gm1527 UTSW 3 28915311 missense possibly damaging 0.95
R7197:Gm1527 UTSW 3 28926541 missense probably null 0.00
R7308:Gm1527 UTSW 3 28902280 missense probably benign 0.02
R7360:Gm1527 UTSW 3 28914542 nonsense probably null
R7380:Gm1527 UTSW 3 28920472 missense probably benign 0.10
R7864:Gm1527 UTSW 3 28926470 missense probably benign 0.01
R7896:Gm1527 UTSW 3 28921593 splice site probably null
R8261:Gm1527 UTSW 3 28920600 missense probably damaging 1.00
R8300:Gm1527 UTSW 3 28926595 missense possibly damaging 0.96
X0021:Gm1527 UTSW 3 28920468 missense probably damaging 1.00
X0028:Gm1527 UTSW 3 28914500 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AGAGACCCTCTGTGTTTGCC -3'
(R):5'- CTTACATAAATTCAGGACCAGTGG -3'

Sequencing Primer
(F):5'- ACTTTTATGATCGAGAACTCTCCTG -3'
(R):5'- CCAGTGGAAAGAGGTACCAAAATTTG -3'
Posted On2019-10-17