Incidental Mutation 'R7566:Magi1'
List |< first << previous [record 27 of 55] next >> last >|
ID585445
Institutional Source Beutler Lab
Gene Symbol Magi1
Ensembl Gene ENSMUSG00000045095
Gene Namemembrane associated guanylate kinase, WW and PDZ domain containing 1
SynonymsAIP3, Baiap1, BAP1, Gukmi1, WWP3
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_010367.2; NM_001083320.1 NM_001029850.3, NM_001083321.1; MGI: 1203522

Is this an essential gene? Probably non essential (E-score: 0.232) question?
Stock #R7566 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location93675455-94283917 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 93678327 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1446 (E1446G)
Ref Sequence ENSEMBL: ENSMUSP00000086730 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055224] [ENSMUST00000089317] [ENSMUST00000093769] [ENSMUST00000203519] [ENSMUST00000203688] [ENSMUST00000204347] [ENSMUST00000204532]
PDB Structure
X-ray crystal structure of MAGI-1 PDZ1 bound to the C-terminal peptide of HPV18 E6 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000055224
SMART Domains Protein: ENSMUSP00000062085
Gene: ENSMUSG00000045095

DomainStartEndE-ValueType
PDZ 26 105 8.04e-5 SMART
GuKc 111 295 2.55e-49 SMART
WW 301 333 9.65e-11 SMART
WW 348 380 2.88e-9 SMART
low complexity region 390 402 N/A INTRINSIC
low complexity region 410 428 N/A INTRINSIC
PDZ 460 536 3.71e-18 SMART
PDZ 631 703 4.68e-15 SMART
low complexity region 707 714 N/A INTRINSIC
low complexity region 720 733 N/A INTRINSIC
PDZ 800 876 4.64e-19 SMART
low complexity region 920 942 N/A INTRINSIC
PDB:1UEW|A 945 977 2e-6 PDB
PDZ 1043 1117 1.26e-20 SMART
low complexity region 1152 1164 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000089317
AA Change: E1446G

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000086730
Gene: ENSMUSG00000045095
AA Change: E1446G

DomainStartEndE-ValueType
PDZ 26 105 4e-7 SMART
GuKc 111 295 1.3e-51 SMART
WW 301 333 5.8e-13 SMART
WW 360 392 1.7e-11 SMART
low complexity region 402 414 N/A INTRINSIC
low complexity region 422 440 N/A INTRINSIC
PDZ 472 548 1.9e-20 SMART
PDZ 643 715 2.3e-17 SMART
low complexity region 733 746 N/A INTRINSIC
PDZ 841 917 2.4e-21 SMART
low complexity region 961 983 N/A INTRINSIC
PDZ 999 1074 6.1e-25 SMART
PDZ 1140 1214 6.1e-23 SMART
low complexity region 1347 1357 N/A INTRINSIC
low complexity region 1366 1423 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000093769
AA Change: E1230G

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000091283
Gene: ENSMUSG00000045095
AA Change: E1230G

DomainStartEndE-ValueType
low complexity region 10 15 N/A INTRINSIC
WW 74 106 9.65e-11 SMART
WW 133 165 2.88e-9 SMART
low complexity region 175 187 N/A INTRINSIC
low complexity region 195 213 N/A INTRINSIC
PDZ 245 321 3.71e-18 SMART
PDZ 416 488 4.68e-15 SMART
low complexity region 492 499 N/A INTRINSIC
low complexity region 505 518 N/A INTRINSIC
PDZ 613 689 4.64e-19 SMART
low complexity region 733 755 N/A INTRINSIC
PDZ 771 858 2.3e-23 SMART
PDZ 924 998 1.26e-20 SMART
low complexity region 1131 1141 N/A INTRINSIC
low complexity region 1150 1207 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203519
SMART Domains Protein: ENSMUSP00000145244
Gene: ENSMUSG00000045095

DomainStartEndE-ValueType
PDZ 26 105 8.04e-5 SMART
GuKc 111 295 2.55e-49 SMART
WW 301 333 9.65e-11 SMART
WW 360 392 2.88e-9 SMART
low complexity region 402 414 N/A INTRINSIC
low complexity region 422 440 N/A INTRINSIC
PDZ 472 548 3.71e-18 SMART
PDZ 643 715 4.68e-15 SMART
low complexity region 719 726 N/A INTRINSIC
low complexity region 732 745 N/A INTRINSIC
PDZ 812 888 4.64e-19 SMART
low complexity region 932 954 N/A INTRINSIC
PDB:1UEW|A 957 989 2e-6 PDB
PDZ 1055 1115 1.13e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203688
SMART Domains Protein: ENSMUSP00000145515
Gene: ENSMUSG00000045095

DomainStartEndE-ValueType
Pfam:MAGI_u1 1 34 2.9e-17 PFAM
WW 74 106 9.65e-11 SMART
WW 133 165 2.88e-9 SMART
low complexity region 175 187 N/A INTRINSIC
low complexity region 195 213 N/A INTRINSIC
PDZ 245 321 3.71e-18 SMART
PDZ 416 488 4.68e-15 SMART
low complexity region 506 519 N/A INTRINSIC
PDZ 614 690 4.64e-19 SMART
low complexity region 734 756 N/A INTRINSIC
PDZ 772 858 1.74e-23 SMART
PDZ 924 998 1.26e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204347
SMART Domains Protein: ENSMUSP00000144881
Gene: ENSMUSG00000045095

DomainStartEndE-ValueType
PDZ 26 105 4e-7 SMART
GuKc 111 295 1.3e-51 SMART
WW 301 333 5.8e-13 SMART
WW 360 392 1.7e-11 SMART
low complexity region 402 414 N/A INTRINSIC
low complexity region 422 440 N/A INTRINSIC
PDZ 472 548 1.9e-20 SMART
PDZ 643 715 2.3e-17 SMART
low complexity region 733 746 N/A INTRINSIC
PDZ 841 917 2.4e-21 SMART
low complexity region 961 983 N/A INTRINSIC
PDZ 999 1086 1.1e-25 SMART
PDZ 1152 1226 6.1e-23 SMART
low complexity region 1261 1273 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204532
SMART Domains Protein: ENSMUSP00000144769
Gene: ENSMUSG00000045095

DomainStartEndE-ValueType
Pfam:MAGI_u1 1 34 1.8e-14 PFAM
WW 74 106 5.8e-13 SMART
WW 133 165 1.7e-11 SMART
low complexity region 175 187 N/A INTRINSIC
low complexity region 195 213 N/A INTRINSIC
PDZ 245 321 1.9e-20 SMART
PDZ 416 488 7.3e-17 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the membrane-associated guanylate kinase homologue (MAGUK) family. MAGUK proteins participate in the assembly of multiprotein complexes on the inner surface of the plasma membrane at regions of cell-cell contact. The product of this gene may play a role as scaffolding protein at cell-cell junctions. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(165) : Targeted(2) Gene trapped(163)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik T G 1: 11,951,028 S420R probably damaging Het
Acat2 C T 17: 12,947,459 D219N probably damaging Het
Anapc10 G A 8: 79,719,679 R46Q possibly damaging Het
Ankub1 G A 3: 57,665,618 R228* probably null Het
Arhgap21 T C 2: 20,912,291 N91S probably benign Het
Arhgap32 T A 9: 32,250,722 V323D probably benign Het
Bcas1 C T 2: 170,370,449 probably null Het
C530008M17Rik G A 5: 76,866,275 probably null Het
Cd109 C T 9: 78,680,837 P716S probably damaging Het
Chd4 C T 6: 125,101,903 P267L possibly damaging Het
Cpne7 G T 8: 123,133,813 V502F probably damaging Het
Dlgap4 C T 2: 156,762,737 A921V probably benign Het
Faap24 G T 7: 35,393,040 R151S probably benign Het
Fam98a A G 17: 75,547,662 S51P probably damaging Het
Fbxl8 A G 8: 105,268,306 D150G possibly damaging Het
Fut10 A G 8: 31,259,922 K412R probably benign Het
G0s2 T C 1: 193,272,768 S3G probably benign Het
Gm1527 T C 3: 28,920,618 Y527H probably benign Het
Gsdmc3 T C 15: 63,861,661 K227R possibly damaging Het
Gtf2ird2 A G 5: 134,214,006 Y354C probably damaging Het
Hmcn2 T A 2: 31,454,857 N4685K probably damaging Het
Itgad A T 7: 128,192,107 Y717F probably benign Het
Kcnh5 C T 12: 75,114,392 W247* probably null Het
Kcnt1 C A 2: 25,916,036 S1212R probably benign Het
Kirrel A G 3: 87,088,484 V381A probably damaging Het
Loxl1 T A 9: 58,312,198 Q230L probably damaging Het
Man1a A G 10: 53,919,234 V550A possibly damaging Het
Mgat4d T C 8: 83,358,023 S132P probably damaging Het
Muc16 T A 9: 18,638,629 H5456L probably benign Het
Nhsl1 A G 10: 18,516,119 K207R probably damaging Het
Nlrp4a A C 7: 26,449,245 probably null Het
Nr6a1 T C 2: 38,731,073 M407V possibly damaging Het
Olfr1360 T G 13: 21,674,567 I126L possibly damaging Het
Olfr156 A G 4: 43,820,711 S217P probably damaging Het
Olfr30 G T 11: 58,455,663 F95L probably benign Het
Olfr776 T C 10: 129,261,600 I213T probably damaging Het
Ovgp1 A G 3: 105,974,310 probably benign Het
Ovol3 G T 7: 30,234,366 F110L probably damaging Het
Pcsk5 T C 19: 17,572,457 T724A probably benign Het
Phtf2 G T 5: 20,765,801 T653N probably damaging Het
Plch1 A T 3: 63,781,242 probably null Het
Prkce A T 17: 86,493,329 E391V probably benign Het
Prob1 A G 18: 35,654,985 V72A probably benign Het
Prrc2b C A 2: 32,194,390 P289Q probably benign Het
Ptbp3 A T 4: 59,514,280 N114K probably benign Het
Rho T A 6: 115,932,174 L57H probably damaging Het
Slc44a5 A C 3: 154,269,989 D679A probably damaging Het
Slit2 A T 5: 48,249,897 D898V probably damaging Het
Spag16 C T 1: 69,870,328 R195C probably damaging Het
Tmprss11a T G 5: 86,444,134 D60A possibly damaging Het
Ttn T A 2: 76,734,949 R28311S probably damaging Het
Wfikkn1 T C 17: 25,878,378 D324G probably damaging Het
Zan A C 5: 137,412,583 probably null Het
Zfp945 A T 17: 22,851,753 C412S possibly damaging Het
Other mutations in Magi1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01376:Magi1 APN 6 94283093 missense possibly damaging 0.86
IGL01457:Magi1 APN 6 93747224 missense probably damaging 0.99
IGL01642:Magi1 APN 6 93686624 missense possibly damaging 0.69
IGL01724:Magi1 APN 6 93792400 unclassified probably null
IGL01967:Magi1 APN 6 93708134 missense probably damaging 1.00
IGL01984:Magi1 APN 6 93708174 missense probably damaging 1.00
IGL02074:Magi1 APN 6 93745598 missense probably damaging 1.00
IGL02098:Magi1 APN 6 93678787 missense probably damaging 1.00
IGL02225:Magi1 APN 6 93694026 missense probably damaging 1.00
IGL02522:Magi1 APN 6 93678636 missense possibly damaging 0.89
IGL02659:Magi1 APN 6 93785610 missense possibly damaging 0.68
IGL02900:Magi1 APN 6 93686873 missense probably damaging 1.00
P0007:Magi1 UTSW 6 93745988 missense probably damaging 1.00
R0149:Magi1 UTSW 6 93747245 missense probably damaging 1.00
R0512:Magi1 UTSW 6 93694064 missense probably damaging 1.00
R1487:Magi1 UTSW 6 93708079 missense probably benign 0.00
R1497:Magi1 UTSW 6 93747329 missense probably damaging 1.00
R1502:Magi1 UTSW 6 93694170 missense probably damaging 1.00
R1824:Magi1 UTSW 6 93699639 missense possibly damaging 0.94
R2042:Magi1 UTSW 6 93755045 missense probably benign
R2132:Magi1 UTSW 6 93697274 missense probably damaging 0.99
R2331:Magi1 UTSW 6 93685562 missense probably damaging 1.00
R2418:Magi1 UTSW 6 93745910 missense probably damaging 1.00
R3076:Magi1 UTSW 6 93757687 missense possibly damaging 0.63
R3551:Magi1 UTSW 6 93699629 missense probably damaging 0.98
R4005:Magi1 UTSW 6 93701318 missense probably damaging 1.00
R4455:Magi1 UTSW 6 93785457 missense probably damaging 1.00
R4670:Magi1 UTSW 6 93686643 splice site probably null
R4671:Magi1 UTSW 6 93680787 critical splice donor site probably null
R4839:Magi1 UTSW 6 93694196 missense probably damaging 1.00
R5132:Magi1 UTSW 6 93683091 critical splice acceptor site probably null
R5147:Magi1 UTSW 6 93747267 missense probably damaging 1.00
R5525:Magi1 UTSW 6 93792373 missense possibly damaging 0.95
R5724:Magi1 UTSW 6 93680871 missense probably benign 0.03
R5724:Magi1 UTSW 6 93745701 missense probably damaging 1.00
R5846:Magi1 UTSW 6 93685603 missense probably damaging 1.00
R5896:Magi1 UTSW 6 93708199 missense probably damaging 1.00
R5912:Magi1 UTSW 6 93708145 missense possibly damaging 0.95
R6112:Magi1 UTSW 6 93745590 missense probably damaging 1.00
R6115:Magi1 UTSW 6 93708070 missense possibly damaging 0.64
R6351:Magi1 UTSW 6 93943229 missense possibly damaging 0.82
R6355:Magi1 UTSW 6 94283196 missense probably benign 0.06
R6457:Magi1 UTSW 6 93699639 missense probably damaging 1.00
R6464:Magi1 UTSW 6 93699789 missense probably damaging 1.00
R6613:Magi1 UTSW 6 93745673 missense probably damaging 1.00
R6661:Magi1 UTSW 6 93943308 missense probably benign 0.08
R6755:Magi1 UTSW 6 93708177 missense probably damaging 1.00
R6909:Magi1 UTSW 6 93697320 missense probably damaging 1.00
R7180:Magi1 UTSW 6 93815750 missense probably benign 0.10
R7224:Magi1 UTSW 6 93683089 missense probably benign 0.34
R7447:Magi1 UTSW 6 93745581 missense possibly damaging 0.63
R7517:Magi1 UTSW 6 93708208 missense probably damaging 0.99
R7537:Magi1 UTSW 6 93708110 nonsense probably null
R7549:Magi1 UTSW 6 93708114 missense probably benign 0.19
R7805:Magi1 UTSW 6 93682946 missense probably benign
R8022:Magi1 UTSW 6 93697365 missense probably damaging 1.00
R8290:Magi1 UTSW 6 94283085 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGATGCTTCCTCAGGTAAGAAAC -3'
(R):5'- CCCGGAGAAAAGATAGCTCC -3'

Sequencing Primer
(F):5'- GCTTCCTCAGGTAAGAAACTAAATG -3'
(R):5'- GACTCCTGGATCAAAGACGGTC -3'
Posted On2019-10-17