Incidental Mutation 'R7566:Rho'
List |< first << previous [record 47 of 55] next >> last >|
ID585446
Institutional Source Beutler Lab
Gene Symbol Rho
Ensembl Gene ENSMUSG00000030324
Gene Namerhodopsin
SynonymsNoerg1, Ops, RP4, Long Wavelength Sensitive opsin, opsin 2, L opsin, LWS opsin, Red Opsin, Opn2, Rod Opsin
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock #R7566 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location115931748-115940036 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 115932174 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 57 (L57H)
Ref Sequence ENSEMBL: ENSMUSP00000032471 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032471] [ENSMUST00000203877] [ENSMUST00000204493] [ENSMUST00000204711]
Predicted Effect probably damaging
Transcript: ENSMUST00000032471
AA Change: L57H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032471
Gene: ENSMUSG00000030324
AA Change: L57H

DomainStartEndE-ValueType
Pfam:Rhodopsin_N 2 37 1e-23 PFAM
Pfam:7TM_GPCR_Srv 40 323 1.2e-12 PFAM
Pfam:7TM_GPCR_Srw 42 324 7.9e-12 PFAM
Pfam:7TM_GPCR_Srsx 48 321 4.9e-11 PFAM
Pfam:7tm_1 54 306 5.1e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203877
SMART Domains Protein: ENSMUSP00000144952
Gene: ENSMUSG00000030324

DomainStartEndE-ValueType
Pfam:7tm_1 6 147 1.6e-17 PFAM
Pfam:7TM_GPCR_Srw 19 165 1.2e-8 PFAM
Pfam:7TM_GPCR_Srsx 25 162 1.2e-4 PFAM
Pfam:7TM_GPCR_Srv 29 164 7.3e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204493
SMART Domains Protein: ENSMUSP00000145464
Gene: ENSMUSG00000030324

DomainStartEndE-ValueType
low complexity region 20 41 N/A INTRINSIC
low complexity region 48 54 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204711
SMART Domains Protein: ENSMUSP00000144768
Gene: ENSMUSG00000030324

DomainStartEndE-ValueType
Pfam:7tm_1 1 164 4.1e-24 PFAM
Pfam:7TM_GPCR_Srw 11 182 5.4e-9 PFAM
Pfam:7TM_GPCR_Srv 13 181 1.6e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Retinitis pigmentosa is an inherited progressive disease which is a major cause of blindness in western communities. It can be inherited as an autosomal dominant, autosomal recessive, or X-linked recessive disorder. In the autosomal dominant form,which comprises about 25% of total cases, approximately 30% of families have mutations in the gene encoding the rod photoreceptor-specific protein rhodopsin. This is the transmembrane protein which, when photoexcited, initiates the visual transduction cascade. Defects in this gene are also one of the causes of congenital stationary night blindness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted null homozygotes fail to develop retinal rod outer segments and lose their photoreceptors while heterozygotes exhibit some disorganization of their photoreceptors and a shortening of the outer segments with age. Some point mutants have only light-induced photoreceptor degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik T G 1: 11,951,028 S420R probably damaging Het
Acat2 C T 17: 12,947,459 D219N probably damaging Het
Anapc10 G A 8: 79,719,679 R46Q possibly damaging Het
Ankub1 G A 3: 57,665,618 R228* probably null Het
Arhgap21 T C 2: 20,912,291 N91S probably benign Het
Arhgap32 T A 9: 32,250,722 V323D probably benign Het
Bcas1 C T 2: 170,370,449 probably null Het
C530008M17Rik G A 5: 76,866,275 probably null Het
Cd109 C T 9: 78,680,837 P716S probably damaging Het
Chd4 C T 6: 125,101,903 P267L possibly damaging Het
Cpne7 G T 8: 123,133,813 V502F probably damaging Het
Dlgap4 C T 2: 156,762,737 A921V probably benign Het
Faap24 G T 7: 35,393,040 R151S probably benign Het
Fam98a A G 17: 75,547,662 S51P probably damaging Het
Fbxl8 A G 8: 105,268,306 D150G possibly damaging Het
Fut10 A G 8: 31,259,922 K412R probably benign Het
G0s2 T C 1: 193,272,768 S3G probably benign Het
Gm1527 T C 3: 28,920,618 Y527H probably benign Het
Gsdmc3 T C 15: 63,861,661 K227R possibly damaging Het
Gtf2ird2 A G 5: 134,214,006 Y354C probably damaging Het
Hmcn2 T A 2: 31,454,857 N4685K probably damaging Het
Itgad A T 7: 128,192,107 Y717F probably benign Het
Kcnh5 C T 12: 75,114,392 W247* probably null Het
Kcnt1 C A 2: 25,916,036 S1212R probably benign Het
Kirrel A G 3: 87,088,484 V381A probably damaging Het
Loxl1 T A 9: 58,312,198 Q230L probably damaging Het
Magi1 T C 6: 93,678,327 E1446G probably benign Het
Man1a A G 10: 53,919,234 V550A possibly damaging Het
Mgat4d T C 8: 83,358,023 S132P probably damaging Het
Muc16 T A 9: 18,638,629 H5456L probably benign Het
Nhsl1 A G 10: 18,516,119 K207R probably damaging Het
Nlrp4a A C 7: 26,449,245 probably null Het
Nr6a1 T C 2: 38,731,073 M407V possibly damaging Het
Olfr1360 T G 13: 21,674,567 I126L possibly damaging Het
Olfr156 A G 4: 43,820,711 S217P probably damaging Het
Olfr30 G T 11: 58,455,663 F95L probably benign Het
Olfr776 T C 10: 129,261,600 I213T probably damaging Het
Ovgp1 A G 3: 105,974,310 probably benign Het
Ovol3 G T 7: 30,234,366 F110L probably damaging Het
Pcsk5 T C 19: 17,572,457 T724A probably benign Het
Phtf2 G T 5: 20,765,801 T653N probably damaging Het
Plch1 A T 3: 63,781,242 probably null Het
Prkce A T 17: 86,493,329 E391V probably benign Het
Prob1 A G 18: 35,654,985 V72A probably benign Het
Prrc2b C A 2: 32,194,390 P289Q probably benign Het
Ptbp3 A T 4: 59,514,280 N114K probably benign Het
Slc44a5 A C 3: 154,269,989 D679A probably damaging Het
Slit2 A T 5: 48,249,897 D898V probably damaging Het
Spag16 C T 1: 69,870,328 R195C probably damaging Het
Tmprss11a T G 5: 86,444,134 D60A possibly damaging Het
Ttn T A 2: 76,734,949 R28311S probably damaging Het
Wfikkn1 T C 17: 25,878,378 D324G probably damaging Het
Zan A C 5: 137,412,583 probably null Het
Zfp945 A T 17: 22,851,753 C412S possibly damaging Het
Other mutations in Rho
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02432:Rho APN 6 115932185 missense probably damaging 0.99
IGL02480:Rho APN 6 115935544 missense probably benign 0.20
IGL02625:Rho APN 6 115935197 missense possibly damaging 0.95
bemr3 UTSW 6 115935131 missense probably damaging 1.00
R0165:Rho UTSW 6 115932227 missense probably damaging 1.00
R1167:Rho UTSW 6 115935423 missense probably damaging 0.98
R1169:Rho UTSW 6 115932238 missense probably damaging 1.00
R1312:Rho UTSW 6 115935605 missense probably damaging 1.00
R2393:Rho UTSW 6 115935391 splice site probably benign
R3895:Rho UTSW 6 115933902 missense probably damaging 1.00
R4414:Rho UTSW 6 115935230 missense probably benign
R4416:Rho UTSW 6 115935230 missense probably benign
R5753:Rho UTSW 6 115935487 missense probably damaging 1.00
R6483:Rho UTSW 6 115932257 missense possibly damaging 0.78
R6552:Rho UTSW 6 115931748 unclassified probably null
R6719:Rho UTSW 6 115933893 missense possibly damaging 0.58
R7030:Rho UTSW 6 115935543 missense possibly damaging 0.93
R7354:Rho UTSW 6 115935503 nonsense probably null
R7674:Rho UTSW 6 115932333 missense probably damaging 1.00
R7699:Rho UTSW 6 115935239 missense probably damaging 0.98
R7700:Rho UTSW 6 115935239 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTGGTCTCTGTCTACGAAGAGC -3'
(R):5'- GCAAAGAAGCCCTCGAGATTAC -3'

Sequencing Primer
(F):5'- TCTGTCTACGAAGAGCCCGTG -3'
(R):5'- CCTCGAGATTACAGCCTGTG -3'
Posted On2019-10-17