Incidental Mutation 'R7566:Faap24'
List |< first << previous [record 13 of 55] next >> last >|
ID585450
Institutional Source Beutler Lab
Gene Symbol Faap24
Ensembl Gene ENSMUSG00000030493
Gene NameFanconi anemia core complex associated protein 24
SynonymsC230052I12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R7566 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location35392152-35396836 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 35393040 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 151 (R151S)
Ref Sequence ENSEMBL: ENSMUSP00000032704 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032704] [ENSMUST00000032705] [ENSMUST00000079414] [ENSMUST00000085556] [ENSMUST00000141704] [ENSMUST00000154597] [ENSMUST00000206854]
Predicted Effect probably benign
Transcript: ENSMUST00000032704
AA Change: R151S

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000032704
Gene: ENSMUSG00000030493
AA Change: R151S

DomainStartEndE-ValueType
Pfam:HHH_2 162 219 1.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000032705
SMART Domains Protein: ENSMUSP00000032705
Gene: ENSMUSG00000030494

DomainStartEndE-ValueType
Hr1 38 101 2.42e-12 SMART
BRO1 111 513 1.27e-167 SMART
PDZ 524 594 1.73e-9 SMART
low complexity region 623 637 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000079414
SMART Domains Protein: ENSMUSP00000078383
Gene: ENSMUSG00000023072

DomainStartEndE-ValueType
low complexity region 27 62 N/A INTRINSIC
low complexity region 181 190 N/A INTRINSIC
coiled coil region 252 291 N/A INTRINSIC
coiled coil region 372 598 N/A INTRINSIC
coiled coil region 670 732 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085556
SMART Domains Protein: ENSMUSP00000082692
Gene: ENSMUSG00000030494

DomainStartEndE-ValueType
Hr1 38 101 2.42e-12 SMART
BRO1 111 513 1.27e-167 SMART
PDZ 524 594 1.73e-9 SMART
low complexity region 623 637 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141704
SMART Domains Protein: ENSMUSP00000121393
Gene: ENSMUSG00000023072

DomainStartEndE-ValueType
low complexity region 27 62 N/A INTRINSIC
low complexity region 181 190 N/A INTRINSIC
coiled coil region 252 291 N/A INTRINSIC
coiled coil region 372 598 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154597
AA Change: R151S

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000115766
Gene: ENSMUSG00000030493
AA Change: R151S

DomainStartEndE-ValueType
Pfam:HHH_2 162 219 2.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000206854
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] FAAP24 is a component of the Fanconi anemia (FA) core complex (see MIM 227650), which plays a crucial role in DNA damage response (Ciccia et al., 2007 [PubMed 17289582]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik T G 1: 11,951,028 S420R probably damaging Het
Acat2 C T 17: 12,947,459 D219N probably damaging Het
Anapc10 G A 8: 79,719,679 R46Q possibly damaging Het
Ankub1 G A 3: 57,665,618 R228* probably null Het
Arhgap21 T C 2: 20,912,291 N91S probably benign Het
Arhgap32 T A 9: 32,250,722 V323D probably benign Het
Bcas1 C T 2: 170,370,449 probably null Het
C530008M17Rik G A 5: 76,866,275 probably null Het
Cd109 C T 9: 78,680,837 P716S probably damaging Het
Chd4 C T 6: 125,101,903 P267L possibly damaging Het
Cpne7 G T 8: 123,133,813 V502F probably damaging Het
Dlgap4 C T 2: 156,762,737 A921V probably benign Het
Fam98a A G 17: 75,547,662 S51P probably damaging Het
Fbxl8 A G 8: 105,268,306 D150G possibly damaging Het
Fut10 A G 8: 31,259,922 K412R probably benign Het
G0s2 T C 1: 193,272,768 S3G probably benign Het
Gm1527 T C 3: 28,920,618 Y527H probably benign Het
Gsdmc3 T C 15: 63,861,661 K227R possibly damaging Het
Gtf2ird2 A G 5: 134,214,006 Y354C probably damaging Het
Hmcn2 T A 2: 31,454,857 N4685K probably damaging Het
Itgad A T 7: 128,192,107 Y717F probably benign Het
Kcnh5 C T 12: 75,114,392 W247* probably null Het
Kcnt1 C A 2: 25,916,036 S1212R probably benign Het
Kirrel A G 3: 87,088,484 V381A probably damaging Het
Loxl1 T A 9: 58,312,198 Q230L probably damaging Het
Magi1 T C 6: 93,678,327 E1446G probably benign Het
Man1a A G 10: 53,919,234 V550A possibly damaging Het
Mgat4d T C 8: 83,358,023 S132P probably damaging Het
Muc16 T A 9: 18,638,629 H5456L probably benign Het
Nhsl1 A G 10: 18,516,119 K207R probably damaging Het
Nlrp4a A C 7: 26,449,245 probably null Het
Nr6a1 T C 2: 38,731,073 M407V possibly damaging Het
Olfr1360 T G 13: 21,674,567 I126L possibly damaging Het
Olfr156 A G 4: 43,820,711 S217P probably damaging Het
Olfr30 G T 11: 58,455,663 F95L probably benign Het
Olfr776 T C 10: 129,261,600 I213T probably damaging Het
Ovgp1 A G 3: 105,974,310 probably benign Het
Ovol3 G T 7: 30,234,366 F110L probably damaging Het
Pcsk5 T C 19: 17,572,457 T724A probably benign Het
Phtf2 G T 5: 20,765,801 T653N probably damaging Het
Plch1 A T 3: 63,781,242 probably null Het
Prkce A T 17: 86,493,329 E391V probably benign Het
Prob1 A G 18: 35,654,985 V72A probably benign Het
Prrc2b C A 2: 32,194,390 P289Q probably benign Het
Ptbp3 A T 4: 59,514,280 N114K probably benign Het
Rho T A 6: 115,932,174 L57H probably damaging Het
Slc44a5 A C 3: 154,269,989 D679A probably damaging Het
Slit2 A T 5: 48,249,897 D898V probably damaging Het
Spag16 C T 1: 69,870,328 R195C probably damaging Het
Tmprss11a T G 5: 86,444,134 D60A possibly damaging Het
Ttn T A 2: 76,734,949 R28311S probably damaging Het
Wfikkn1 T C 17: 25,878,378 D324G probably damaging Het
Zan A C 5: 137,412,583 probably null Het
Zfp945 A T 17: 22,851,753 C412S possibly damaging Het
Other mutations in Faap24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02265:Faap24 APN 7 35396264 missense probably benign 0.01
IGL02951:Faap24 APN 7 35392951 missense probably damaging 0.98
IGL03351:Faap24 APN 7 35395309 nonsense probably null
R0030:Faap24 UTSW 7 35392860 missense probably damaging 0.97
R0606:Faap24 UTSW 7 35394963 unclassified probably benign
R1378:Faap24 UTSW 7 35392901 missense probably benign 0.06
R3749:Faap24 UTSW 7 35393012 missense possibly damaging 0.94
R4661:Faap24 UTSW 7 35395084 missense probably benign 0.00
R6279:Faap24 UTSW 7 35396284 missense possibly damaging 0.90
R7025:Faap24 UTSW 7 35392871 missense possibly damaging 0.84
R7074:Faap24 UTSW 7 35395102 missense possibly damaging 0.92
R7171:Faap24 UTSW 7 35392854 nonsense probably null
R7249:Faap24 UTSW 7 35395060 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTGAAGGCAGAGTCAGCTG -3'
(R):5'- AGCCACACAGATATTTGGGG -3'

Sequencing Primer
(F):5'- TCGCTTAGGCTGGGTGAAGAAG -3'
(R):5'- CCATTCAGGTTCAAGAGC -3'
Posted On2019-10-17