Incidental Mutation 'R7566:Fbxl8'
ID585455
Institutional Source Beutler Lab
Gene Symbol Fbxl8
Ensembl Gene ENSMUSG00000033313
Gene NameF-box and leucine-rich repeat protein 8
SynonymsFBL8
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7566 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location105264648-105269326 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 105268306 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 150 (D150G)
Ref Sequence ENSEMBL: ENSMUSP00000038638 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034359] [ENSMUST00000036127] [ENSMUST00000036221] [ENSMUST00000126923] [ENSMUST00000144762] [ENSMUST00000163734] [ENSMUST00000172525] [ENSMUST00000173102] [ENSMUST00000173640] [ENSMUST00000173859] [ENSMUST00000174837]
Predicted Effect probably benign
Transcript: ENSMUST00000034359
SMART Domains Protein: ENSMUSP00000034359
Gene: ENSMUSG00000031887

DomainStartEndE-ValueType
Pfam:TRADD_N 51 161 2.9e-49 PFAM
DEATH 203 303 1.14e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000036127
SMART Domains Protein: ENSMUSP00000048904
Gene: ENSMUSG00000033249

DomainStartEndE-ValueType
HSF 16 120 1.74e-62 SMART
Blast:HSF 159 383 8e-88 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000036221
AA Change: D150G

PolyPhen 2 Score 0.825 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000038638
Gene: ENSMUSG00000033313
AA Change: D150G

DomainStartEndE-ValueType
FBOX 8 48 2.72e-6 SMART
low complexity region 102 113 N/A INTRINSIC
low complexity region 252 263 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126923
SMART Domains Protein: ENSMUSP00000115366
Gene: ENSMUSG00000033313

DomainStartEndE-ValueType
FBOX 8 48 2.72e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144762
SMART Domains Protein: ENSMUSP00000119174
Gene: ENSMUSG00000031887

DomainStartEndE-ValueType
PDB:1F2H|A 1 50 7e-23 PDB
SCOP:d1f3va_ 8 50 4e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163734
SMART Domains Protein: ENSMUSP00000126278
Gene: ENSMUSG00000033249

DomainStartEndE-ValueType
HSF 9 60 1.43e-1 SMART
Blast:HSF 99 323 2e-88 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000172525
SMART Domains Protein: ENSMUSP00000134206
Gene: ENSMUSG00000033249

DomainStartEndE-ValueType
HSF 16 120 1.74e-62 SMART
Blast:HSF 159 243 3e-36 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000173102
Predicted Effect probably benign
Transcript: ENSMUST00000173640
SMART Domains Protein: ENSMUSP00000133532
Gene: ENSMUSG00000033249

DomainStartEndE-ValueType
HSF 16 120 1.74e-62 SMART
Blast:HSF 159 284 1e-50 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000173859
SMART Domains Protein: ENSMUSP00000134213
Gene: ENSMUSG00000033249

DomainStartEndE-ValueType
HSF 16 120 1.74e-62 SMART
Blast:HSF 159 353 1e-46 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000174837
SMART Domains Protein: ENSMUSP00000134477
Gene: ENSMUSG00000033249

DomainStartEndE-ValueType
HSF 16 120 1.74e-62 SMART
Blast:HSF 159 290 3e-50 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbls class. It shares 78% sequence identity with the mouse protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik T G 1: 11,951,028 S420R probably damaging Het
Acat2 C T 17: 12,947,459 D219N probably damaging Het
Anapc10 G A 8: 79,719,679 R46Q possibly damaging Het
Ankub1 G A 3: 57,665,618 R228* probably null Het
Arhgap21 T C 2: 20,912,291 N91S probably benign Het
Arhgap32 T A 9: 32,250,722 V323D probably benign Het
Bcas1 C T 2: 170,370,449 probably null Het
C530008M17Rik G A 5: 76,866,275 probably null Het
Cd109 C T 9: 78,680,837 P716S probably damaging Het
Chd4 C T 6: 125,101,903 P267L possibly damaging Het
Cpne7 G T 8: 123,133,813 V502F probably damaging Het
Dlgap4 C T 2: 156,762,737 A921V probably benign Het
Faap24 G T 7: 35,393,040 R151S probably benign Het
Fam98a A G 17: 75,547,662 S51P probably damaging Het
Fut10 A G 8: 31,259,922 K412R probably benign Het
G0s2 T C 1: 193,272,768 S3G probably benign Het
Gm1527 T C 3: 28,920,618 Y527H probably benign Het
Gsdmc3 T C 15: 63,861,661 K227R possibly damaging Het
Gtf2ird2 A G 5: 134,214,006 Y354C probably damaging Het
Hmcn2 T A 2: 31,454,857 N4685K probably damaging Het
Itgad A T 7: 128,192,107 Y717F probably benign Het
Kcnh5 C T 12: 75,114,392 W247* probably null Het
Kcnt1 C A 2: 25,916,036 S1212R probably benign Het
Kirrel A G 3: 87,088,484 V381A probably damaging Het
Loxl1 T A 9: 58,312,198 Q230L probably damaging Het
Magi1 T C 6: 93,678,327 E1446G probably benign Het
Man1a A G 10: 53,919,234 V550A possibly damaging Het
Mgat4d T C 8: 83,358,023 S132P probably damaging Het
Muc16 T A 9: 18,638,629 H5456L probably benign Het
Nhsl1 A G 10: 18,516,119 K207R probably damaging Het
Nlrp4a A C 7: 26,449,245 probably null Het
Nr6a1 T C 2: 38,731,073 M407V possibly damaging Het
Olfr1360 T G 13: 21,674,567 I126L possibly damaging Het
Olfr156 A G 4: 43,820,711 S217P probably damaging Het
Olfr30 G T 11: 58,455,663 F95L probably benign Het
Olfr776 T C 10: 129,261,600 I213T probably damaging Het
Ovgp1 A G 3: 105,974,310 probably benign Het
Ovol3 G T 7: 30,234,366 F110L probably damaging Het
Pcsk5 T C 19: 17,572,457 T724A probably benign Het
Phtf2 G T 5: 20,765,801 T653N probably damaging Het
Plch1 A T 3: 63,781,242 probably null Het
Prkce A T 17: 86,493,329 E391V probably benign Het
Prob1 A G 18: 35,654,985 V72A probably benign Het
Prrc2b C A 2: 32,194,390 P289Q probably benign Het
Ptbp3 A T 4: 59,514,280 N114K probably benign Het
Rho T A 6: 115,932,174 L57H probably damaging Het
Slc44a5 A C 3: 154,269,989 D679A probably damaging Het
Slit2 A T 5: 48,249,897 D898V probably damaging Het
Spag16 C T 1: 69,870,328 R195C probably damaging Het
Tmprss11a T G 5: 86,444,134 D60A possibly damaging Het
Ttn T A 2: 76,734,949 R28311S probably damaging Het
Wfikkn1 T C 17: 25,878,378 D324G probably damaging Het
Zan A C 5: 137,412,583 probably null Het
Zfp945 A T 17: 22,851,753 C412S possibly damaging Het
Other mutations in Fbxl8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02794:Fbxl8 APN 8 105268120 missense probably benign 0.01
IGL03405:Fbxl8 APN 8 105268120 missense probably benign 0.07
R0993:Fbxl8 UTSW 8 105267085 missense probably damaging 1.00
R1861:Fbxl8 UTSW 8 105268929 missense probably damaging 1.00
R2042:Fbxl8 UTSW 8 105268224 missense probably damaging 0.96
R3848:Fbxl8 UTSW 8 105267149 missense probably benign 0.04
R3850:Fbxl8 UTSW 8 105267149 missense probably benign 0.04
R4957:Fbxl8 UTSW 8 105268195 missense probably damaging 0.99
R5153:Fbxl8 UTSW 8 105267107 missense probably damaging 1.00
R5161:Fbxl8 UTSW 8 105268906 missense possibly damaging 0.71
R6597:Fbxl8 UTSW 8 105268891 missense probably benign 0.00
R6603:Fbxl8 UTSW 8 105268210 missense probably damaging 0.98
R6962:Fbxl8 UTSW 8 105268706 missense possibly damaging 0.71
R7044:Fbxl8 UTSW 8 105267015 start codon destroyed probably null 0.99
R8027:Fbxl8 UTSW 8 105268126 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CAACCTAAGGCTGGAATATGAGC -3'
(R):5'- CTCAGTGCCAGAAGTGCAAAAG -3'

Sequencing Primer
(F):5'- CTGGAATATGAGCCATCAAAGAAGCC -3'
(R):5'- TAGCAATTCCAGCGCGG -3'
Posted On2019-10-17