Incidental Mutation 'R7566:Man1a'
ID585462
Institutional Source Beutler Lab
Gene Symbol Man1a
Ensembl Gene ENSMUSG00000003746
Gene Namemannosidase 1, alpha
Synonymsmannosyl-oligosaccharide alpha-1,2-mannosidase, PCR1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.625) question?
Stock #R7566 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location53904785-54076609 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 53919234 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 550 (V550A)
Ref Sequence ENSEMBL: ENSMUSP00000003843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003843] [ENSMUST00000105470] [ENSMUST00000218317] [ENSMUST00000220088]
PDB Structure
Structure of mouse Golgi alpha-1,2-mannosidase IA reveals the molecular basis for substrate specificity among Class I enzymes (family 47 glycosidases) [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000003843
AA Change: V550A

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000003843
Gene: ENSMUSG00000003746
AA Change: V550A

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
transmembrane domain 44 66 N/A INTRINSIC
coiled coil region 116 151 N/A INTRINSIC
Pfam:Glyco_hydro_47 204 642 4.6e-150 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000105470
AA Change: V550A

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101110
Gene: ENSMUSG00000003746
AA Change: V550A

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
transmembrane domain 44 66 N/A INTRINSIC
coiled coil region 116 151 N/A INTRINSIC
Pfam:Glyco_hydro_47 204 642 4.5e-153 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218317
Predicted Effect possibly damaging
Transcript: ENSMUST00000220088
AA Change: V641A

PolyPhen 2 Score 0.475 (Sensitivity: 0.89; Specificity: 0.90)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a class I mammalian Golgi 1,2-mannosidase which is a type II transmembrane protein. This protein catalyzes the hydrolysis of three terminal mannose residues from peptide-bound Man(9)-GlcNAc(2) oligosaccharides and belongs to family 47 of glycosyl hydrolases. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik T G 1: 11,951,028 S420R probably damaging Het
Acat2 C T 17: 12,947,459 D219N probably damaging Het
Anapc10 G A 8: 79,719,679 R46Q possibly damaging Het
Ankub1 G A 3: 57,665,618 R228* probably null Het
Arhgap21 T C 2: 20,912,291 N91S probably benign Het
Arhgap32 T A 9: 32,250,722 V323D probably benign Het
Bcas1 C T 2: 170,370,449 probably null Het
C530008M17Rik G A 5: 76,866,275 probably null Het
Cd109 C T 9: 78,680,837 P716S probably damaging Het
Chd4 C T 6: 125,101,903 P267L possibly damaging Het
Cpne7 G T 8: 123,133,813 V502F probably damaging Het
Dlgap4 C T 2: 156,762,737 A921V probably benign Het
Faap24 G T 7: 35,393,040 R151S probably benign Het
Fam98a A G 17: 75,547,662 S51P probably damaging Het
Fbxl8 A G 8: 105,268,306 D150G possibly damaging Het
Fut10 A G 8: 31,259,922 K412R probably benign Het
G0s2 T C 1: 193,272,768 S3G probably benign Het
Gm1527 T C 3: 28,920,618 Y527H probably benign Het
Gsdmc3 T C 15: 63,861,661 K227R possibly damaging Het
Gtf2ird2 A G 5: 134,214,006 Y354C probably damaging Het
Hmcn2 T A 2: 31,454,857 N4685K probably damaging Het
Itgad A T 7: 128,192,107 Y717F probably benign Het
Kcnh5 C T 12: 75,114,392 W247* probably null Het
Kcnt1 C A 2: 25,916,036 S1212R probably benign Het
Kirrel A G 3: 87,088,484 V381A probably damaging Het
Loxl1 T A 9: 58,312,198 Q230L probably damaging Het
Magi1 T C 6: 93,678,327 E1446G probably benign Het
Mgat4d T C 8: 83,358,023 S132P probably damaging Het
Muc16 T A 9: 18,638,629 H5456L probably benign Het
Nhsl1 A G 10: 18,516,119 K207R probably damaging Het
Nlrp4a A C 7: 26,449,245 probably null Het
Nr6a1 T C 2: 38,731,073 M407V possibly damaging Het
Olfr1360 T G 13: 21,674,567 I126L possibly damaging Het
Olfr156 A G 4: 43,820,711 S217P probably damaging Het
Olfr30 G T 11: 58,455,663 F95L probably benign Het
Olfr776 T C 10: 129,261,600 I213T probably damaging Het
Ovgp1 A G 3: 105,974,310 probably benign Het
Ovol3 G T 7: 30,234,366 F110L probably damaging Het
Pcsk5 T C 19: 17,572,457 T724A probably benign Het
Phtf2 G T 5: 20,765,801 T653N probably damaging Het
Plch1 A T 3: 63,781,242 probably null Het
Prkce A T 17: 86,493,329 E391V probably benign Het
Prob1 A G 18: 35,654,985 V72A probably benign Het
Prrc2b C A 2: 32,194,390 P289Q probably benign Het
Ptbp3 A T 4: 59,514,280 N114K probably benign Het
Rho T A 6: 115,932,174 L57H probably damaging Het
Slc44a5 A C 3: 154,269,989 D679A probably damaging Het
Slit2 A T 5: 48,249,897 D898V probably damaging Het
Spag16 C T 1: 69,870,328 R195C probably damaging Het
Tmprss11a T G 5: 86,444,134 D60A possibly damaging Het
Ttn T A 2: 76,734,949 R28311S probably damaging Het
Wfikkn1 T C 17: 25,878,378 D324G probably damaging Het
Zan A C 5: 137,412,583 probably null Het
Zfp945 A T 17: 22,851,753 C412S possibly damaging Het
Other mutations in Man1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01111:Man1a APN 10 53977013 splice site probably benign
IGL01146:Man1a APN 10 53907519 missense possibly damaging 0.90
IGL01412:Man1a APN 10 54074714 missense probably benign 0.00
IGL02009:Man1a APN 10 53925525 missense probably damaging 1.00
IGL02026:Man1a APN 10 54014473 missense probably damaging 1.00
IGL02745:Man1a APN 10 53977110 missense probably damaging 0.99
IGL02851:Man1a APN 10 53919244 missense probably damaging 1.00
IGL02929:Man1a APN 10 53925435 missense probably benign 0.00
R0046:Man1a UTSW 10 53919187 missense probably damaging 1.00
R0046:Man1a UTSW 10 53919187 missense probably damaging 1.00
R0101:Man1a UTSW 10 54075024 start codon destroyed probably null
R0200:Man1a UTSW 10 54074498 missense probably damaging 0.96
R0463:Man1a UTSW 10 54074498 missense probably damaging 0.96
R0947:Man1a UTSW 10 53933523 nonsense probably null
R1219:Man1a UTSW 10 53919153 splice site probably benign
R1876:Man1a UTSW 10 53919172 missense probably damaging 1.00
R2142:Man1a UTSW 10 53934998 missense probably damaging 1.00
R2219:Man1a UTSW 10 53977049 missense probably damaging 0.99
R3117:Man1a UTSW 10 54030794 missense probably damaging 0.97
R3119:Man1a UTSW 10 54030794 missense probably damaging 0.97
R4727:Man1a UTSW 10 53907572 splice site probably null
R4942:Man1a UTSW 10 53933490 critical splice donor site probably null
R5493:Man1a UTSW 10 54074480 missense probably benign 0.25
R5921:Man1a UTSW 10 53907510 missense probably damaging 0.97
R5965:Man1a UTSW 10 53933490 critical splice donor site probably benign
R6084:Man1a UTSW 10 53919211 missense probably damaging 1.00
R6199:Man1a UTSW 10 54014456 missense possibly damaging 0.70
R6362:Man1a UTSW 10 54074795 missense probably benign 0.25
R6543:Man1a UTSW 10 53934981 nonsense probably null
R6711:Man1a UTSW 10 53933492 missense probably benign 0.00
R6982:Man1a UTSW 10 54074723 missense possibly damaging 0.92
R7061:Man1a UTSW 10 53920235 missense probably damaging 1.00
R7063:Man1a UTSW 10 54030744 missense probably damaging 1.00
R7220:Man1a UTSW 10 53920235 missense possibly damaging 0.95
R7361:Man1a UTSW 10 53908009 missense probably damaging 1.00
R7392:Man1a UTSW 10 53919187 missense probably damaging 1.00
R7864:Man1a UTSW 10 54030747 missense possibly damaging 0.88
R7947:Man1a UTSW 10 54030747 missense possibly damaging 0.88
Z1176:Man1a UTSW 10 53919315 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGAGCGGAATGACCTTGATAAAG -3'
(R):5'- TCTAACTAGCCCTTAATCACACTGG -3'

Sequencing Primer
(F):5'- GTATGGAAATCTCAGAAAAGTTGCC -3'
(R):5'- AGCCCTTAATCACACTGGGGTTTC -3'
Posted On2019-10-17