Incidental Mutation 'R7566:Olfr776'
ID585463
Institutional Source Beutler Lab
Gene Symbol Olfr776
Ensembl Gene ENSMUSG00000095483
Gene Nameolfactory receptor 776
SynonymsGA_x6K02T2PULF-10947193-10948131, MOR111-12
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R7566 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location129259127-129264298 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 129261600 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 213 (I213T)
Ref Sequence ENSEMBL: ENSMUSP00000150656 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073704] [ENSMUST00000204573] [ENSMUST00000213512]
Predicted Effect probably damaging
Transcript: ENSMUST00000073704
AA Change: I213T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000073383
Gene: ENSMUSG00000095483
AA Change: I213T

DomainStartEndE-ValueType
Pfam:7tm_4 29 307 8.3e-50 PFAM
Pfam:7tm_1 39 288 3.9e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204573
SMART Domains Protein: ENSMUSP00000145475
Gene: ENSMUSG00000062914

DomainStartEndE-ValueType
Pfam:7tm_4 28 307 1.4e-42 PFAM
Pfam:7tm_1 38 287 1.5e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213512
AA Change: I213T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Meta Mutation Damage Score 0.3502 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik T G 1: 11,951,028 S420R probably damaging Het
Acat2 C T 17: 12,947,459 D219N probably damaging Het
Anapc10 G A 8: 79,719,679 R46Q possibly damaging Het
Ankub1 G A 3: 57,665,618 R228* probably null Het
Arhgap21 T C 2: 20,912,291 N91S probably benign Het
Arhgap32 T A 9: 32,250,722 V323D probably benign Het
Bcas1 C T 2: 170,370,449 probably null Het
C530008M17Rik G A 5: 76,866,275 probably null Het
Cd109 C T 9: 78,680,837 P716S probably damaging Het
Chd4 C T 6: 125,101,903 P267L possibly damaging Het
Cpne7 G T 8: 123,133,813 V502F probably damaging Het
Dlgap4 C T 2: 156,762,737 A921V probably benign Het
Faap24 G T 7: 35,393,040 R151S probably benign Het
Fam98a A G 17: 75,547,662 S51P probably damaging Het
Fbxl8 A G 8: 105,268,306 D150G possibly damaging Het
Fut10 A G 8: 31,259,922 K412R probably benign Het
G0s2 T C 1: 193,272,768 S3G probably benign Het
Gm1527 T C 3: 28,920,618 Y527H probably benign Het
Gsdmc3 T C 15: 63,861,661 K227R possibly damaging Het
Gtf2ird2 A G 5: 134,214,006 Y354C probably damaging Het
Hmcn2 T A 2: 31,454,857 N4685K probably damaging Het
Itgad A T 7: 128,192,107 Y717F probably benign Het
Kcnh5 C T 12: 75,114,392 W247* probably null Het
Kcnt1 C A 2: 25,916,036 S1212R probably benign Het
Kirrel A G 3: 87,088,484 V381A probably damaging Het
Loxl1 T A 9: 58,312,198 Q230L probably damaging Het
Magi1 T C 6: 93,678,327 E1446G probably benign Het
Man1a A G 10: 53,919,234 V550A possibly damaging Het
Mgat4d T C 8: 83,358,023 S132P probably damaging Het
Muc16 T A 9: 18,638,629 H5456L probably benign Het
Nhsl1 A G 10: 18,516,119 K207R probably damaging Het
Nlrp4a A C 7: 26,449,245 probably null Het
Nr6a1 T C 2: 38,731,073 M407V possibly damaging Het
Olfr1360 T G 13: 21,674,567 I126L possibly damaging Het
Olfr156 A G 4: 43,820,711 S217P probably damaging Het
Olfr30 G T 11: 58,455,663 F95L probably benign Het
Ovgp1 A G 3: 105,974,310 probably benign Het
Ovol3 G T 7: 30,234,366 F110L probably damaging Het
Pcsk5 T C 19: 17,572,457 T724A probably benign Het
Phtf2 G T 5: 20,765,801 T653N probably damaging Het
Plch1 A T 3: 63,781,242 probably null Het
Prkce A T 17: 86,493,329 E391V probably benign Het
Prob1 A G 18: 35,654,985 V72A probably benign Het
Prrc2b C A 2: 32,194,390 P289Q probably benign Het
Ptbp3 A T 4: 59,514,280 N114K probably benign Het
Rho T A 6: 115,932,174 L57H probably damaging Het
Slc44a5 A C 3: 154,269,989 D679A probably damaging Het
Slit2 A T 5: 48,249,897 D898V probably damaging Het
Spag16 C T 1: 69,870,328 R195C probably damaging Het
Tmprss11a T G 5: 86,444,134 D60A possibly damaging Het
Ttn T A 2: 76,734,949 R28311S probably damaging Het
Wfikkn1 T C 17: 25,878,378 D324G probably damaging Het
Zan A C 5: 137,412,583 probably null Het
Zfp945 A T 17: 22,851,753 C412S possibly damaging Het
Other mutations in Olfr776
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01444:Olfr776 APN 10 129261335 missense probably damaging 1.00
IGL01956:Olfr776 APN 10 129261042 missense possibly damaging 0.88
IGL03299:Olfr776 APN 10 129261327 missense probably benign 0.26
IGL03388:Olfr776 APN 10 129261443 missense probably benign 0.00
IGL02802:Olfr776 UTSW 10 129261267 unclassified probably null
R1538:Olfr776 UTSW 10 129261213 missense probably damaging 0.99
R3711:Olfr776 UTSW 10 129261224 nonsense probably null
R3712:Olfr776 UTSW 10 129261224 nonsense probably null
R4201:Olfr776 UTSW 10 129261777 missense probably benign 0.19
R4202:Olfr776 UTSW 10 129261777 missense probably benign 0.19
R4726:Olfr776 UTSW 10 129261176 missense possibly damaging 0.84
R5029:Olfr776 UTSW 10 129261838 missense probably benign 0.15
R5623:Olfr776 UTSW 10 129261032 missense probably benign 0.17
R7678:Olfr776 UTSW 10 129261068 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTCATGGCTGGCAGGATTTC -3'
(R):5'- ATTGAAGTATTGAGAACAGCCACC -3'

Sequencing Primer
(F):5'- GGCAGGATTTCTGAGCATCTTCC -3'
(R):5'- GTATTGAGAACAGCCACCCCTTTG -3'
Posted On2019-10-17