Incidental Mutation 'R7566:Acat2'
List |< first << previous [record 2 of 55] next >> last >|
ID585468
Institutional Source Beutler Lab
Gene Symbol Acat2
Ensembl Gene ENSMUSG00000023832
Gene Nameacetyl-Coenzyme A acetyltransferase 2
SynonymsTcp-1x, Tcp1-rs1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7566 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location12942890-12960747 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 12947459 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 219 (D219N)
Ref Sequence ENSEMBL: ENSMUSP00000007005 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007005] [ENSMUST00000159697]
Predicted Effect probably damaging
Transcript: ENSMUST00000007005
AA Change: D219N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000007005
Gene: ENSMUSG00000023832
AA Change: D219N

DomainStartEndE-ValueType
Pfam:Thiolase_N 8 267 8e-99 PFAM
Pfam:Thiolase_C 274 396 1.8e-52 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159697
AA Change: D187N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125066
Gene: ENSMUSG00000023832
AA Change: D187N

DomainStartEndE-ValueType
Pfam:Thiolase_N 1 235 3.9e-91 PFAM
Pfam:Thiolase_C 242 364 2.4e-53 PFAM
Pfam:ACP_syn_III_C 273 364 9.7e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik T G 1: 11,951,028 S420R probably damaging Het
Anapc10 G A 8: 79,719,679 R46Q possibly damaging Het
Ankub1 G A 3: 57,665,618 R228* probably null Het
Arhgap21 T C 2: 20,912,291 N91S probably benign Het
Arhgap32 T A 9: 32,250,722 V323D probably benign Het
Bcas1 C T 2: 170,370,449 probably null Het
C530008M17Rik G A 5: 76,866,275 probably null Het
Cd109 C T 9: 78,680,837 P716S probably damaging Het
Chd4 C T 6: 125,101,903 P267L possibly damaging Het
Cpne7 G T 8: 123,133,813 V502F probably damaging Het
Dlgap4 C T 2: 156,762,737 A921V probably benign Het
Faap24 G T 7: 35,393,040 R151S probably benign Het
Fam98a A G 17: 75,547,662 S51P probably damaging Het
Fbxl8 A G 8: 105,268,306 D150G possibly damaging Het
Fut10 A G 8: 31,259,922 K412R probably benign Het
G0s2 T C 1: 193,272,768 S3G probably benign Het
Gm1527 T C 3: 28,920,618 Y527H probably benign Het
Gsdmc3 T C 15: 63,861,661 K227R possibly damaging Het
Gtf2ird2 A G 5: 134,214,006 Y354C probably damaging Het
Hmcn2 T A 2: 31,454,857 N4685K probably damaging Het
Itgad A T 7: 128,192,107 Y717F probably benign Het
Kcnh5 C T 12: 75,114,392 W247* probably null Het
Kcnt1 C A 2: 25,916,036 S1212R probably benign Het
Kirrel A G 3: 87,088,484 V381A probably damaging Het
Loxl1 T A 9: 58,312,198 Q230L probably damaging Het
Magi1 T C 6: 93,678,327 E1446G probably benign Het
Man1a A G 10: 53,919,234 V550A possibly damaging Het
Mgat4d T C 8: 83,358,023 S132P probably damaging Het
Muc16 T A 9: 18,638,629 H5456L probably benign Het
Nhsl1 A G 10: 18,516,119 K207R probably damaging Het
Nlrp4a A C 7: 26,449,245 probably null Het
Nr6a1 T C 2: 38,731,073 M407V possibly damaging Het
Olfr1360 T G 13: 21,674,567 I126L possibly damaging Het
Olfr156 A G 4: 43,820,711 S217P probably damaging Het
Olfr30 G T 11: 58,455,663 F95L probably benign Het
Olfr776 T C 10: 129,261,600 I213T probably damaging Het
Ovgp1 A G 3: 105,974,310 probably benign Het
Ovol3 G T 7: 30,234,366 F110L probably damaging Het
Pcsk5 T C 19: 17,572,457 T724A probably benign Het
Phtf2 G T 5: 20,765,801 T653N probably damaging Het
Plch1 A T 3: 63,781,242 probably null Het
Prkce A T 17: 86,493,329 E391V probably benign Het
Prob1 A G 18: 35,654,985 V72A probably benign Het
Prrc2b C A 2: 32,194,390 P289Q probably benign Het
Ptbp3 A T 4: 59,514,280 N114K probably benign Het
Rho T A 6: 115,932,174 L57H probably damaging Het
Slc44a5 A C 3: 154,269,989 D679A probably damaging Het
Slit2 A T 5: 48,249,897 D898V probably damaging Het
Spag16 C T 1: 69,870,328 R195C probably damaging Het
Tmprss11a T G 5: 86,444,134 D60A possibly damaging Het
Ttn T A 2: 76,734,949 R28311S probably damaging Het
Wfikkn1 T C 17: 25,878,378 D324G probably damaging Het
Zan A C 5: 137,412,583 probably null Het
Zfp945 A T 17: 22,851,753 C412S possibly damaging Het
Other mutations in Acat2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01920:Acat2 APN 17 12944025 missense probably benign 0.00
R0243:Acat2 UTSW 17 12944021 missense probably benign
R4153:Acat2 UTSW 17 12952266 missense possibly damaging 0.88
R4224:Acat2 UTSW 17 12962885 unclassified probably benign
R4332:Acat2 UTSW 17 12962895 unclassified probably benign
R6219:Acat2 UTSW 17 12960717 unclassified probably benign
R6605:Acat2 UTSW 17 12943887 missense probably benign 0.07
R6683:Acat2 UTSW 17 12943927 missense probably benign 0.00
R7313:Acat2 UTSW 17 12960006 missense probably benign 0.18
R8294:Acat2 UTSW 17 12956356 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GTTGTGTAGAAAGACGTATTCACTTGG -3'
(R):5'- TTTGAAACACAGGGTGAGCG -3'

Sequencing Primer
(F):5'- ACTTGGTAGACCTCCACAGAGTTG -3'
(R):5'- TCTCATGGGAGAGCATGCAGTAATTC -3'
Posted On2019-10-17