Incidental Mutation 'R7566:Zfp945'
List |< first << previous [record 55 of 55]
ID585469
Institutional Source Beutler Lab
Gene Symbol Zfp945
Ensembl Gene ENSMUSG00000059142
Gene Namezinc finger protein 945
SynonymsA630033E08Rik, C730040L01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R7566 (G1)
Quality Score170.009
Status Validated
Chromosome17
Chromosomal Location22846697-22867134 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 22851753 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 412 (C412S)
Ref Sequence ENSEMBL: ENSMUSP00000124123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088696] [ENSMUST00000150092] [ENSMUST00000160457]
Predicted Effect probably benign
Transcript: ENSMUST00000088696
AA Change: C391S

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000086074
Gene: ENSMUSG00000059142
AA Change: C391S

DomainStartEndE-ValueType
KRAB 13 68 9.12e-18 SMART
ZnF_C2H2 210 232 1.45e-2 SMART
ZnF_C2H2 238 260 1.03e-2 SMART
ZnF_C2H2 266 288 1.76e-1 SMART
ZnF_C2H2 322 344 7.37e-4 SMART
ZnF_C2H2 350 372 1.5e-4 SMART
ZnF_C2H2 378 400 5.14e-3 SMART
ZnF_C2H2 406 428 9.73e-4 SMART
ZnF_C2H2 434 456 2.99e-4 SMART
ZnF_C2H2 462 484 4.54e-4 SMART
ZnF_C2H2 490 512 2.4e-3 SMART
ZnF_C2H2 518 540 1.38e-3 SMART
ZnF_C2H2 546 568 1.13e-4 SMART
ZnF_C2H2 574 596 5.59e-4 SMART
ZnF_C2H2 602 624 9.31e1 SMART
ZnF_C2H2 630 652 7.9e-4 SMART
ZnF_C2H2 658 680 3.69e-4 SMART
ZnF_C2H2 686 708 3.16e-3 SMART
ZnF_C2H2 714 736 2.95e-3 SMART
ZnF_C2H2 742 764 1.98e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150092
SMART Domains Protein: ENSMUSP00000117978
Gene: ENSMUSG00000059142

DomainStartEndE-ValueType
KRAB 34 89 9.12e-18 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000160457
AA Change: C412S

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000124123
Gene: ENSMUSG00000059142
AA Change: C412S

DomainStartEndE-ValueType
KRAB 34 89 9.12e-18 SMART
ZnF_C2H2 231 253 1.45e-2 SMART
ZnF_C2H2 259 281 1.03e-2 SMART
ZnF_C2H2 287 309 1.76e-1 SMART
ZnF_C2H2 343 365 7.37e-4 SMART
ZnF_C2H2 371 393 1.5e-4 SMART
ZnF_C2H2 399 421 5.14e-3 SMART
ZnF_C2H2 427 449 9.73e-4 SMART
ZnF_C2H2 455 477 2.99e-4 SMART
ZnF_C2H2 483 505 4.54e-4 SMART
ZnF_C2H2 511 533 2.4e-3 SMART
ZnF_C2H2 539 561 1.38e-3 SMART
ZnF_C2H2 567 589 1.13e-4 SMART
ZnF_C2H2 595 617 5.59e-4 SMART
ZnF_C2H2 623 645 9.31e1 SMART
ZnF_C2H2 651 673 7.9e-4 SMART
ZnF_C2H2 679 701 3.69e-4 SMART
ZnF_C2H2 707 729 3.16e-3 SMART
ZnF_C2H2 735 757 2.95e-3 SMART
ZnF_C2H2 763 785 1.98e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik T G 1: 11,951,028 S420R probably damaging Het
Acat2 C T 17: 12,947,459 D219N probably damaging Het
Anapc10 G A 8: 79,719,679 R46Q possibly damaging Het
Ankub1 G A 3: 57,665,618 R228* probably null Het
Arhgap21 T C 2: 20,912,291 N91S probably benign Het
Arhgap32 T A 9: 32,250,722 V323D probably benign Het
Bcas1 C T 2: 170,370,449 probably null Het
C530008M17Rik G A 5: 76,866,275 probably null Het
Cd109 C T 9: 78,680,837 P716S probably damaging Het
Chd4 C T 6: 125,101,903 P267L possibly damaging Het
Cpne7 G T 8: 123,133,813 V502F probably damaging Het
Dlgap4 C T 2: 156,762,737 A921V probably benign Het
Faap24 G T 7: 35,393,040 R151S probably benign Het
Fam98a A G 17: 75,547,662 S51P probably damaging Het
Fbxl8 A G 8: 105,268,306 D150G possibly damaging Het
Fut10 A G 8: 31,259,922 K412R probably benign Het
G0s2 T C 1: 193,272,768 S3G probably benign Het
Gm1527 T C 3: 28,920,618 Y527H probably benign Het
Gsdmc3 T C 15: 63,861,661 K227R possibly damaging Het
Gtf2ird2 A G 5: 134,214,006 Y354C probably damaging Het
Hmcn2 T A 2: 31,454,857 N4685K probably damaging Het
Itgad A T 7: 128,192,107 Y717F probably benign Het
Kcnh5 C T 12: 75,114,392 W247* probably null Het
Kcnt1 C A 2: 25,916,036 S1212R probably benign Het
Kirrel A G 3: 87,088,484 V381A probably damaging Het
Loxl1 T A 9: 58,312,198 Q230L probably damaging Het
Magi1 T C 6: 93,678,327 E1446G probably benign Het
Man1a A G 10: 53,919,234 V550A possibly damaging Het
Mgat4d T C 8: 83,358,023 S132P probably damaging Het
Muc16 T A 9: 18,638,629 H5456L probably benign Het
Nhsl1 A G 10: 18,516,119 K207R probably damaging Het
Nlrp4a A C 7: 26,449,245 probably null Het
Nr6a1 T C 2: 38,731,073 M407V possibly damaging Het
Olfr1360 T G 13: 21,674,567 I126L possibly damaging Het
Olfr156 A G 4: 43,820,711 S217P probably damaging Het
Olfr30 G T 11: 58,455,663 F95L probably benign Het
Olfr776 T C 10: 129,261,600 I213T probably damaging Het
Ovgp1 A G 3: 105,974,310 probably benign Het
Ovol3 G T 7: 30,234,366 F110L probably damaging Het
Pcsk5 T C 19: 17,572,457 T724A probably benign Het
Phtf2 G T 5: 20,765,801 T653N probably damaging Het
Plch1 A T 3: 63,781,242 probably null Het
Prkce A T 17: 86,493,329 E391V probably benign Het
Prob1 A G 18: 35,654,985 V72A probably benign Het
Prrc2b C A 2: 32,194,390 P289Q probably benign Het
Ptbp3 A T 4: 59,514,280 N114K probably benign Het
Rho T A 6: 115,932,174 L57H probably damaging Het
Slc44a5 A C 3: 154,269,989 D679A probably damaging Het
Slit2 A T 5: 48,249,897 D898V probably damaging Het
Spag16 C T 1: 69,870,328 R195C probably damaging Het
Tmprss11a T G 5: 86,444,134 D60A possibly damaging Het
Ttn T A 2: 76,734,949 R28311S probably damaging Het
Wfikkn1 T C 17: 25,878,378 D324G probably damaging Het
Zan A C 5: 137,412,583 probably null Het
Other mutations in Zfp945
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Zfp945 APN 17 22851957 unclassified probably benign
IGL01077:Zfp945 APN 17 22852385 missense probably damaging 0.99
IGL02706:Zfp945 APN 17 22857282 missense probably damaging 1.00
IGL03408:Zfp945 APN 17 22852537 nonsense probably null
small-scale UTSW 17 22850981 missense probably damaging 1.00
R0427:Zfp945 UTSW 17 22865252 missense probably benign 0.10
R0718:Zfp945 UTSW 17 22851030 missense probably damaging 1.00
R1305:Zfp945 UTSW 17 22852386 missense probably damaging 0.97
R1801:Zfp945 UTSW 17 22851762 missense probably damaging 0.97
R1837:Zfp945 UTSW 17 22851273 missense probably damaging 1.00
R2001:Zfp945 UTSW 17 22857249 critical splice donor site probably null
R4193:Zfp945 UTSW 17 22851170 unclassified probably benign
R4247:Zfp945 UTSW 17 22850609 missense probably damaging 0.98
R5026:Zfp945 UTSW 17 22850885 missense probably damaging 1.00
R5918:Zfp945 UTSW 17 22850981 missense probably damaging 1.00
R6076:Zfp945 UTSW 17 22851458 missense probably damaging 1.00
R6664:Zfp945 UTSW 17 22852365 missense probably damaging 0.99
R6997:Zfp945 UTSW 17 22852569 nonsense probably null
R7040:Zfp945 UTSW 17 22852290 missense probably damaging 0.98
R7479:Zfp945 UTSW 17 22851366 missense possibly damaging 0.93
R7948:Zfp945 UTSW 17 22852122 missense unknown
X0063:Zfp945 UTSW 17 22852228 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GATGAATTCTAAGGTGGTCTTTCC -3'
(R):5'- GTGAATGCCATTACCGTGCTG -3'

Sequencing Primer
(F):5'- CCGGTGGAAGGATTTGTCACAG -3'
(R):5'- GCCATTACCGTGCTGATATAAG -3'
Posted On2019-10-17