Incidental Mutation 'R0619:Os9'
ID58547
Institutional Source Beutler Lab
Gene Symbol Os9
Ensembl Gene ENSMUSG00000040462
Gene Nameamplified in osteosarcoma
Synonyms4632413K17Rik
MMRRC Submission 038808-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0619 (G1)
Quality Score209
Status Not validated
Chromosome10
Chromosomal Location127095650-127121131 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 127120991 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 43 (I43T)
Ref Sequence ENSEMBL: ENSMUSP00000128914 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080975] [ENSMUST00000164259] [ENSMUST00000218798]
Predicted Effect probably damaging
Transcript: ENSMUST00000080975
AA Change: I43T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000079770
Gene: ENSMUSG00000040462
AA Change: I43T

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
low complexity region 54 65 N/A INTRINSIC
Pfam:PRKCSH 108 181 2.3e-19 PFAM
low complexity region 317 331 N/A INTRINSIC
low complexity region 337 346 N/A INTRINSIC
coiled coil region 418 449 N/A INTRINSIC
low complexity region 518 533 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164259
AA Change: I43T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128914
Gene: ENSMUSG00000040462
AA Change: I43T

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
low complexity region 54 65 N/A INTRINSIC
Pfam:PRKCSH 108 181 8.6e-19 PFAM
low complexity region 317 331 N/A INTRINSIC
low complexity region 337 346 N/A INTRINSIC
coiled coil region 418 449 N/A INTRINSIC
low complexity region 518 551 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000218798
AA Change: I42T

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is highly expressed in osteosarcomas. This protein binds to the hypoxia-inducible factor 1 (HIF-1), a key regulator of the hypoxic response and angiogenesis, and promotes the degradation of one of its subunits. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adad2 G A 8: 119,613,000 D74N probably benign Het
Adgre4 T A 17: 55,820,679 V573D possibly damaging Het
Ak7 A G 12: 105,733,511 K230E probably damaging Het
Amdhd2 T C 17: 24,156,588 D375G possibly damaging Het
Anpep T C 7: 79,841,009 E253G probably benign Het
Bbs7 A G 3: 36,607,576 L158S probably benign Het
BC037034 A G 5: 138,263,826 probably benign Het
Bdp1 T C 13: 100,037,858 T2057A probably benign Het
C2 G T 17: 34,872,503 H61Q probably damaging Het
Ccdc18 A G 5: 108,180,416 K661E probably benign Het
Cdh23 C T 10: 60,433,777 V655I probably damaging Het
Cep78 T C 19: 15,978,862 T238A probably damaging Het
Ces2a T A 8: 104,736,110 N110K probably benign Het
Crat T C 2: 30,409,984 D128G probably benign Het
Dclre1a A T 19: 56,545,409 M233K probably benign Het
Dsg4 T C 18: 20,461,359 V515A probably benign Het
Fer1l6 T C 15: 58,662,935 probably null Het
Fryl T C 5: 73,068,731 D1863G probably benign Het
Fsip2 T A 2: 82,944,140 L57Q probably damaging Het
Gnb4 C T 3: 32,591,207 V112I probably benign Het
Iqsec1 T C 6: 90,670,406 probably null Het
Kcnn3 A C 3: 89,652,030 T536P probably damaging Het
Kctd3 T C 1: 188,978,643 D441G probably damaging Het
Kifc3 G A 8: 95,102,665 T528M probably benign Het
Kmt2c G A 5: 25,298,916 T3798I probably benign Het
Map1a T A 2: 121,305,255 M1946K probably damaging Het
Mfhas1 T A 8: 35,590,675 V768E probably benign Het
Mroh8 C A 2: 157,265,081 V223F possibly damaging Het
Mss51 A T 14: 20,487,573 V30E probably benign Het
Mtmr10 G A 7: 64,321,213 R392H probably benign Het
Mup3 T C 4: 62,085,961 N105S probably benign Het
Myh7b T C 2: 155,611,722 M22T probably benign Het
Olfr1034 T A 2: 86,047,311 Y276* probably null Het
Olfr170 T A 16: 19,606,272 Y132F probably damaging Het
Olfr97 T A 17: 37,232,155 I72F possibly damaging Het
Pkhd1l1 T C 15: 44,483,838 L200P probably damaging Het
Ptpru C T 4: 131,820,887 V100M possibly damaging Het
Rnf6 G A 5: 146,210,721 R496C possibly damaging Het
Rsad1 C T 11: 94,542,639 R407Q probably damaging Het
Rspo3 T C 10: 29,504,637 D127G probably damaging Het
Sbf2 T A 7: 110,310,262 T1760S possibly damaging Het
Sh2d3c T A 2: 32,753,025 V588E probably damaging Het
Siglech A T 7: 55,769,162 T238S probably benign Het
Slc15a2 T A 16: 36,759,307 N328I probably damaging Het
Slc16a11 G T 11: 70,215,032 G94C probably damaging Het
Stub1 T C 17: 25,831,322 probably null Het
Tacc2 T A 7: 130,716,753 V40D probably damaging Het
Tagln3 C A 16: 45,724,272 R12L probably damaging Het
Tsen54 A G 11: 115,815,064 E69G probably damaging Het
Tsks A G 7: 44,950,834 E150G probably damaging Het
Ubap2l A C 3: 90,017,220 V680G probably benign Het
Usp16 A T 16: 87,472,164 H315L probably benign Het
Vav2 A G 2: 27,296,121 probably null Het
Zfc3h1 T C 10: 115,420,810 F1562L possibly damaging Het
Zfp764 C A 7: 127,406,541 V22L probably benign Het
Other mutations in Os9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Os9 APN 10 127097976 missense probably benign
IGL00978:Os9 APN 10 127120509 missense probably damaging 1.00
IGL01683:Os9 APN 10 127100103 missense probably damaging 1.00
IGL01862:Os9 APN 10 127099704 missense probably benign 0.00
IGL01997:Os9 APN 10 127119443 missense probably benign 0.00
IGL02035:Os9 APN 10 127096291 missense possibly damaging 0.60
IGL02039:Os9 APN 10 127096291 missense possibly damaging 0.60
IGL02134:Os9 APN 10 127120992 missense possibly damaging 0.91
IGL02851:Os9 APN 10 127099393 intron probably benign
IGL03169:Os9 APN 10 127098594 missense probably benign 0.08
R0211:Os9 UTSW 10 127121036 missense probably damaging 0.97
R0514:Os9 UTSW 10 127119639 missense probably damaging 1.00
R0930:Os9 UTSW 10 127097055 missense probably damaging 1.00
R1532:Os9 UTSW 10 127098902 missense probably damaging 1.00
R2364:Os9 UTSW 10 127119138 missense possibly damaging 0.90
R4600:Os9 UTSW 10 127098354 missense probably benign 0.06
R4982:Os9 UTSW 10 127121051 missense possibly damaging 0.92
R5850:Os9 UTSW 10 127098479 utr 3 prime probably benign
R6148:Os9 UTSW 10 127099943 missense probably benign 0.05
R6257:Os9 UTSW 10 127119137 missense probably damaging 1.00
R6650:Os9 UTSW 10 127100084 critical splice donor site probably null
R6731:Os9 UTSW 10 127098543 missense probably benign
R7090:Os9 UTSW 10 127099678 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- ACGACCTGGGGAACTAAGGTCTAC -3'
(R):5'- CAATGAAAGCTTGGGGCGCTAATG -3'

Sequencing Primer
(F):5'- CTAAGGTCTACAGTGGGGAGC -3'
(R):5'- CTAATGGGCGGGTGAGGC -3'
Posted On2013-07-11