Incidental Mutation 'R7567:Rims1'
ID585475
Institutional Source Beutler Lab
Gene Symbol Rims1
Ensembl Gene ENSMUSG00000041670
Gene Nameregulating synaptic membrane exocytosis 1
SynonymsRIM1a, RIM1, RIM1alpha, C030033M19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.520) question?
Stock #R7567 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location22286251-22805994 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 22468210 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 620 (Y620H)
Ref Sequence ENSEMBL: ENSMUSP00000095420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081544] [ENSMUST00000097808] [ENSMUST00000097809] [ENSMUST00000097810] [ENSMUST00000097811] [ENSMUST00000115273]
Predicted Effect probably damaging
Transcript: ENSMUST00000081544
AA Change: Y620H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000080259
Gene: ENSMUSG00000041670
AA Change: Y620H

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
coiled coil region 30 52 N/A INTRINSIC
Pfam:FYVE_2 102 205 2.6e-9 PFAM
low complexity region 283 293 N/A INTRINSIC
low complexity region 329 345 N/A INTRINSIC
low complexity region 381 394 N/A INTRINSIC
PDZ 449 528 1.44e-15 SMART
low complexity region 535 551 N/A INTRINSIC
C2 593 703 7.55e-1 SMART
low complexity region 710 721 N/A INTRINSIC
low complexity region 899 934 N/A INTRINSIC
low complexity region 1011 1025 N/A INTRINSIC
C2 1120 1223 7.45e-15 SMART
low complexity region 1245 1253 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000097808
AA Change: Y798H

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000095417
Gene: ENSMUSG00000041670
AA Change: Y798H

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
coiled coil region 30 52 N/A INTRINSIC
Pfam:FYVE_2 102 205 3.3e-10 PFAM
low complexity region 283 293 N/A INTRINSIC
low complexity region 329 345 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000097809
AA Change: Y620H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095418
Gene: ENSMUSG00000041670
AA Change: Y620H

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
coiled coil region 30 52 N/A INTRINSIC
Pfam:FYVE_2 102 205 1e-9 PFAM
low complexity region 283 293 N/A INTRINSIC
low complexity region 329 345 N/A INTRINSIC
low complexity region 381 394 N/A INTRINSIC
PDZ 449 528 1.44e-15 SMART
low complexity region 535 551 N/A INTRINSIC
C2 593 703 7.55e-1 SMART
low complexity region 710 721 N/A INTRINSIC
low complexity region 862 874 N/A INTRINSIC
low complexity region 974 1009 N/A INTRINSIC
low complexity region 1086 1100 N/A INTRINSIC
C2 1195 1298 7.45e-15 SMART
low complexity region 1320 1328 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000097810
AA Change: Y620H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095419
Gene: ENSMUSG00000041670
AA Change: Y620H

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
coiled coil region 30 52 N/A INTRINSIC
PDB:2CJS|C 131 193 2e-32 PDB
low complexity region 283 293 N/A INTRINSIC
low complexity region 329 345 N/A INTRINSIC
low complexity region 381 394 N/A INTRINSIC
PDZ 449 528 1.44e-15 SMART
low complexity region 535 551 N/A INTRINSIC
C2 593 703 7.55e-1 SMART
low complexity region 710 721 N/A INTRINSIC
low complexity region 862 874 N/A INTRINSIC
low complexity region 916 929 N/A INTRINSIC
low complexity region 1035 1070 N/A INTRINSIC
low complexity region 1147 1161 N/A INTRINSIC
C2 1256 1359 7.45e-15 SMART
low complexity region 1381 1389 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000097811
AA Change: Y620H

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000095420
Gene: ENSMUSG00000041670
AA Change: Y620H

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
coiled coil region 30 52 N/A INTRINSIC
Pfam:FYVE_2 102 205 1.6e-9 PFAM
low complexity region 283 293 N/A INTRINSIC
low complexity region 329 345 N/A INTRINSIC
low complexity region 381 394 N/A INTRINSIC
PDZ 449 528 1.44e-15 SMART
low complexity region 535 551 N/A INTRINSIC
C2 593 703 7.55e-1 SMART
low complexity region 710 721 N/A INTRINSIC
low complexity region 867 881 N/A INTRINSIC
low complexity region 944 957 N/A INTRINSIC
low complexity region 1063 1098 N/A INTRINSIC
low complexity region 1175 1189 N/A INTRINSIC
C2 1284 1387 7.45e-15 SMART
low complexity region 1409 1417 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115273
AA Change: Y620H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110928
Gene: ENSMUSG00000041670
AA Change: Y620H

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
coiled coil region 30 52 N/A INTRINSIC
Pfam:FYVE_2 102 205 2.8e-9 PFAM
low complexity region 283 293 N/A INTRINSIC
low complexity region 329 345 N/A INTRINSIC
low complexity region 381 394 N/A INTRINSIC
PDZ 449 528 1.44e-15 SMART
low complexity region 535 551 N/A INTRINSIC
C2 593 703 7.55e-1 SMART
low complexity region 710 721 N/A INTRINSIC
low complexity region 950 985 N/A INTRINSIC
low complexity region 1062 1076 N/A INTRINSIC
C2 1171 1274 7.45e-15 SMART
low complexity region 1296 1304 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a RAS gene superfamily member that regulates synaptic vesicle exocytosis. This gene also plays a role in the regulation of voltage-gated calcium channels during neurotransmitter and insulin release. Mutations have suggested a role cognition and have been identified as the cause of cone-rod dystrophy type 7. Multiple transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for disruptions in this gene display defects in maternal care and abnormalities in synaptic transmission in the central nervous system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik A T 17: 9,008,006 Q464H probably damaging Het
1810041L15Rik G A 15: 84,406,713 T131M probably benign Het
2210010C04Rik C A 6: 41,033,193 R69L probably benign Het
Abcc5 A T 16: 20,405,510 S108T probably damaging Het
Acss3 T C 10: 107,123,313 S91G probably benign Het
Adgrf4 T A 17: 42,667,442 I337L probably benign Het
Adgrv1 A G 13: 81,433,529 S4799P probably benign Het
Adgrv1 T C 13: 81,579,477 D348G probably damaging Het
Afdn A G 17: 13,888,808 D1546G probably benign Het
Agr2 A T 12: 35,995,947 R64S probably benign Het
Ankrd13a T A 5: 114,789,484 probably null Het
Apon T A 10: 128,255,053 M200K possibly damaging Het
Art4 T C 6: 136,854,430 S238G possibly damaging Het
Atp2a2 A T 5: 122,491,784 V74D probably benign Het
Atrnl1 T C 19: 57,699,523 S807P probably damaging Het
B020004J07Rik T C 4: 101,837,134 N184S probably benign Het
C2cd3 T C 7: 100,430,815 V936A Het
Car15 T A 16: 17,836,788 H122L probably damaging Het
Cav3 A T 6: 112,472,467 R149W probably benign Het
Ccdc8 A T 7: 16,994,762 I59F probably damaging Het
Ccng2 G A 5: 93,270,872 V119I probably benign Het
Ceacam2 A G 7: 25,527,908 I178T probably benign Het
Ces2a A G 8: 104,741,298 D520G probably benign Het
Cln8 T C 8: 14,895,057 S124P probably benign Het
Coro2a T A 4: 46,546,674 D227V probably damaging Het
Cpa4 A C 6: 30,573,890 R32S probably benign Het
Creb3l4 G T 3: 90,242,422 D45E probably benign Het
Crybb2 C T 5: 113,065,893 probably null Het
Cul7 T A 17: 46,654,595 H566Q probably benign Het
Cyp2b10 A G 7: 25,914,779 Y226C probably damaging Het
Dennd2a A T 6: 39,522,809 V274D probably benign Het
Dmbt1 G A 7: 131,061,363 probably null Het
Drc7 T C 8: 95,068,056 I363T probably benign Het
Drd3 G A 16: 43,822,684 V396I probably benign Het
Eif2ak4 A G 2: 118,450,314 N1054S probably benign Het
Epc1 A C 18: 6,450,084 V458G probably damaging Het
Exoc1 T A 5: 76,537,715 D91E probably damaging Het
Fat4 T A 3: 38,889,336 F793I probably damaging Het
Fhod1 T C 8: 105,347,837 E6G unknown Het
Galnt16 G A 12: 80,581,310 probably null Het
Ganc A T 2: 120,456,101 T804S probably benign Het
Gpam A T 19: 55,081,630 V398E possibly damaging Het
Gpr68 A G 12: 100,878,364 V307A probably benign Het
Grm7 C T 6: 111,358,761 S711L probably damaging Het
Hemgn T A 4: 46,397,034 R67S probably damaging Het
Hmg20b T C 10: 81,346,659 D281G possibly damaging Het
Ifi211 A C 1: 173,901,835 F277V probably damaging Het
Ighmbp2 T C 19: 3,272,981 I322V probably benign Het
Iqce A T 5: 140,686,075 L265H probably damaging Het
Itgal G T 7: 127,299,788 A101S probably benign Het
Kif5a C T 10: 127,237,379 M647I probably benign Het
Kirrel G T 3: 87,095,681 T135K probably damaging Het
Klf16 T C 10: 80,576,788 Y138C probably benign Het
Klhl7 A G 5: 24,126,846 T49A probably benign Het
Mr1 T C 1: 155,146,728 probably benign Het
Mrc1 A T 2: 14,325,293 I1238F probably damaging Het
Ncoa5 C T 2: 165,004,251 M225I possibly damaging Het
Nf1 A T 11: 79,547,226 T121S probably damaging Het
Ngfr T C 11: 95,574,321 T234A probably benign Het
Ninj1 T G 13: 49,193,880 F74V probably damaging Het
Npffr1 T C 10: 61,626,309 V408A probably benign Het
Nsd2 T C 5: 33,846,226 V240A probably damaging Het
Olfr103 T A 17: 37,337,171 E20D probably benign Het
Olfr1351 T A 10: 79,017,545 F74L probably benign Het
Olfr30 A G 11: 58,455,166 M261T probably damaging Het
Olfr907 G A 9: 38,499,073 V135I probably benign Het
Olfr954 T C 9: 39,461,877 S146P possibly damaging Het
Ovol1 T C 19: 5,551,586 H136R probably damaging Het
Prag1 T A 8: 36,102,606 D114E possibly damaging Het
Prss57 T A 10: 79,787,400 H71L probably benign Het
Ptgs2 T C 1: 150,102,697 F187L probably damaging Het
Ptprz1 A T 6: 22,959,780 N92I probably damaging Het
Rab23 A T 1: 33,734,731 T91S possibly damaging Het
Rag1 A G 2: 101,643,661 S379P probably damaging Het
Ribc2 G T 15: 85,143,247 D310Y probably damaging Het
Rnf219 T C 14: 104,479,378 T520A probably damaging Het
Rock1 A C 18: 10,090,820 V938G probably benign Het
Rsph10b A G 5: 143,949,426 N314S possibly damaging Het
Sertad1 A G 7: 27,489,902 D216G possibly damaging Het
Slco6d1 T A 1: 98,497,527 V600D probably damaging Het
Snapc2 T C 8: 4,255,314 I232T probably damaging Het
Snx13 A G 12: 35,086,914 S125G probably damaging Het
Srcin1 C T 11: 97,534,725 R502H probably damaging Het
Tesmin A G 19: 3,392,218 E167G possibly damaging Het
Tex10 T C 4: 48,468,787 I129M possibly damaging Het
Tmem235 A G 11: 117,864,141 S140G probably benign Het
Trim60 T A 8: 65,001,525 D24V probably damaging Het
Ttc39c A G 18: 12,689,879 E148G probably benign Het
Vmn2r70 G T 7: 85,565,035 T303K probably benign Het
Wdr48 A T 9: 119,916,828 T426S possibly damaging Het
Wdr60 A T 12: 116,254,510 probably null Het
Xirp2 A T 2: 67,515,982 T2856S probably benign Het
Zswim8 A G 14: 20,719,933 N1356S probably damaging Het
Other mutations in Rims1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Rims1 APN 1 22468242 missense probably damaging 1.00
IGL00535:Rims1 APN 1 22432921 missense probably benign 0.02
IGL01021:Rims1 APN 1 22486620 missense probably damaging 1.00
IGL01106:Rims1 APN 1 22379447 missense probably damaging 1.00
IGL01128:Rims1 APN 1 22534175 missense probably damaging 0.97
IGL01548:Rims1 APN 1 22538602 missense probably damaging 1.00
IGL01688:Rims1 APN 1 22397540 missense probably benign 0.22
IGL02089:Rims1 APN 1 22630475 missense possibly damaging 0.68
IGL02245:Rims1 APN 1 22346488 missense probably damaging 0.98
IGL02355:Rims1 APN 1 22483207 missense probably damaging 1.00
IGL02362:Rims1 APN 1 22483207 missense probably damaging 1.00
IGL02682:Rims1 APN 1 22288484 missense probably damaging 1.00
IGL03006:Rims1 APN 1 22296954 missense probably damaging 0.99
IGL03054:Rims1 UTSW 1 22290109 missense probably damaging 1.00
PIT4504001:Rims1 UTSW 1 22397460 missense
R0031:Rims1 UTSW 1 22296879 missense probably damaging 1.00
R0118:Rims1 UTSW 1 22346407 missense probably damaging 1.00
R0390:Rims1 UTSW 1 22596526 missense possibly damaging 0.92
R0483:Rims1 UTSW 1 22468182 splice site probably benign
R0744:Rims1 UTSW 1 22427459 splice site probably null
R0836:Rims1 UTSW 1 22427459 splice site probably null
R1218:Rims1 UTSW 1 22483175 missense probably damaging 1.00
R1228:Rims1 UTSW 1 22472756 missense probably null 1.00
R1374:Rims1 UTSW 1 22296948 missense probably damaging 1.00
R1474:Rims1 UTSW 1 22538281 splice site probably benign
R1652:Rims1 UTSW 1 22292866 missense probably damaging 1.00
R1712:Rims1 UTSW 1 22296948 missense probably damaging 1.00
R1730:Rims1 UTSW 1 22346529 critical splice acceptor site probably null
R1783:Rims1 UTSW 1 22346529 critical splice acceptor site probably null
R1861:Rims1 UTSW 1 22596558 missense probably damaging 1.00
R1899:Rims1 UTSW 1 22428474 missense probably damaging 1.00
R1937:Rims1 UTSW 1 22288530 missense probably damaging 1.00
R2010:Rims1 UTSW 1 22296996 missense probably damaging 1.00
R2049:Rims1 UTSW 1 22596435 missense probably damaging 1.00
R2124:Rims1 UTSW 1 22404508 nonsense probably null
R2860:Rims1 UTSW 1 22432976 missense probably benign 0.01
R2861:Rims1 UTSW 1 22432976 missense probably benign 0.01
R2914:Rims1 UTSW 1 22805630 missense probably damaging 1.00
R3740:Rims1 UTSW 1 22373443 missense probably damaging 1.00
R3741:Rims1 UTSW 1 22373443 missense probably damaging 1.00
R3773:Rims1 UTSW 1 22421810 missense probably damaging 1.00
R3874:Rims1 UTSW 1 22428489 missense probably damaging 1.00
R3901:Rims1 UTSW 1 22533497 missense probably benign 0.00
R3964:Rims1 UTSW 1 22427459 splice site probably null
R4037:Rims1 UTSW 1 22475712 missense probably damaging 0.96
R4039:Rims1 UTSW 1 22475712 missense probably damaging 0.96
R4056:Rims1 UTSW 1 22292939 splice site probably benign
R4062:Rims1 UTSW 1 22533583 missense probably benign 0.00
R4552:Rims1 UTSW 1 22373494 missense probably damaging 0.99
R4658:Rims1 UTSW 1 22427543 missense probably damaging 0.98
R4688:Rims1 UTSW 1 22479447 nonsense probably null
R4696:Rims1 UTSW 1 22288612 missense probably damaging 1.00
R4720:Rims1 UTSW 1 22427481 missense probably damaging 1.00
R4764:Rims1 UTSW 1 22479462 missense probably damaging 1.00
R4780:Rims1 UTSW 1 22291105 missense probably damaging 1.00
R4931:Rims1 UTSW 1 22533947 missense probably benign 0.26
R5137:Rims1 UTSW 1 22288620 nonsense probably null
R5153:Rims1 UTSW 1 22483247 nonsense probably null
R5305:Rims1 UTSW 1 22596542 missense probably damaging 0.99
R5354:Rims1 UTSW 1 22538511 missense probably damaging 1.00
R5386:Rims1 UTSW 1 22412245 missense probably damaging 0.99
R5485:Rims1 UTSW 1 22483208 missense possibly damaging 0.93
R5643:Rims1 UTSW 1 22538509 missense probably damaging 1.00
R5929:Rims1 UTSW 1 22468241 missense probably damaging 1.00
R5988:Rims1 UTSW 1 22596463 missense probably damaging 1.00
R6160:Rims1 UTSW 1 22432984 missense probably damaging 0.98
R6579:Rims1 UTSW 1 22425916 missense probably damaging 1.00
R6790:Rims1 UTSW 1 22468197 missense probably damaging 1.00
R7048:Rims1 UTSW 1 22472820 missense probably damaging 1.00
R7100:Rims1 UTSW 1 22346473 missense probably benign 0.27
R7155:Rims1 UTSW 1 22432923 missense probably damaging 0.99
R7171:Rims1 UTSW 1 22428489 missense
R7448:Rims1 UTSW 1 22404475 missense
R7505:Rims1 UTSW 1 22533996 missense possibly damaging 0.55
R7639:Rims1 UTSW 1 22805669 missense probably benign 0.02
R8005:Rims1 UTSW 1 22412213 missense
Z1088:Rims1 UTSW 1 22288586 missense probably damaging 1.00
Z1176:Rims1 UTSW 1 22484671 nonsense probably null
Z1177:Rims1 UTSW 1 22296939 missense possibly damaging 0.93
Z1177:Rims1 UTSW 1 22468241 missense probably damaging 1.00
Z1177:Rims1 UTSW 1 22472777 missense probably benign 0.44
Z1177:Rims1 UTSW 1 22472804 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGCATTTTAATGAAGTGGATCAAC -3'
(R):5'- ATGCTTCCAAATCACTGTAATTCC -3'

Sequencing Primer
(F):5'- GCAGTTTGGTCCCCTAAA -3'
(R):5'- CCTGTGTTCTCTATAGGAGGAACAAC -3'
Posted On2019-10-17