Incidental Mutation 'R7567:Ces2a'
ID 585521
Institutional Source Beutler Lab
Gene Symbol Ces2a
Ensembl Gene ENSMUSG00000055730
Gene Name carboxylesterase 2A
Synonyms 9130231C15Rik, Ces6
MMRRC Submission 045629-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.055) question?
Stock # R7567 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 105460635-105468266 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 105467930 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 520 (D520G)
Ref Sequence ENSEMBL: ENSMUSP00000034346 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034346] [ENSMUST00000161824] [ENSMUST00000164182]
AlphaFold Q8QZR3
Predicted Effect probably benign
Transcript: ENSMUST00000034346
AA Change: D520G

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000034346
Gene: ENSMUSG00000055730
AA Change: D520G

DomainStartEndE-ValueType
Pfam:COesterase 9 537 1.2e-171 PFAM
Pfam:Abhydrolase_3 142 267 2.9e-11 PFAM
Pfam:Peptidase_S9 156 347 7e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159303
Predicted Effect probably benign
Transcript: ENSMUST00000161824
Predicted Effect probably benign
Transcript: ENSMUST00000164182
AA Change: D487G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000127346
Gene: ENSMUSG00000055730
AA Change: D487G

DomainStartEndE-ValueType
Pfam:COesterase 8 276 5e-110 PFAM
Pfam:Abhydrolase_3 142 267 2.6e-11 PFAM
Pfam:Peptidase_S9 156 275 3e-7 PFAM
Pfam:COesterase 259 504 8.3e-47 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik A T 17: 9,226,838 (GRCm39) Q464H probably damaging Het
Abcc5 A T 16: 20,224,260 (GRCm39) S108T probably damaging Het
Acss3 T C 10: 106,959,174 (GRCm39) S91G probably benign Het
Adgrf4 T A 17: 42,978,333 (GRCm39) I337L probably benign Het
Adgrv1 A G 13: 81,581,648 (GRCm39) S4799P probably benign Het
Adgrv1 T C 13: 81,727,596 (GRCm39) D348G probably damaging Het
Afdn A G 17: 14,109,070 (GRCm39) D1546G probably benign Het
Agr2 A T 12: 36,045,946 (GRCm39) R64S probably benign Het
Ankrd13a T A 5: 114,927,545 (GRCm39) probably null Het
Apon T A 10: 128,090,922 (GRCm39) M200K possibly damaging Het
Art4 T C 6: 136,831,428 (GRCm39) S238G possibly damaging Het
Atp2a2 A T 5: 122,629,847 (GRCm39) V74D probably benign Het
Atrnl1 T C 19: 57,687,955 (GRCm39) S807P probably damaging Het
C2cd3 T C 7: 100,080,022 (GRCm39) V936A Het
Car15 T A 16: 17,654,652 (GRCm39) H122L probably damaging Het
Cav3 A T 6: 112,449,428 (GRCm39) R149W probably benign Het
Ccdc8 A T 7: 16,728,687 (GRCm39) I59F probably damaging Het
Ccng2 G A 5: 93,418,731 (GRCm39) V119I probably benign Het
Ceacam2 A G 7: 25,227,333 (GRCm39) I178T probably benign Het
Cln8 T C 8: 14,945,057 (GRCm39) S124P probably benign Het
Coro2a T A 4: 46,546,674 (GRCm39) D227V probably damaging Het
Cpa4 A C 6: 30,573,889 (GRCm39) R32S probably benign Het
Creb3l4 G T 3: 90,149,729 (GRCm39) D45E probably benign Het
Crybb2 C T 5: 113,213,759 (GRCm39) probably null Het
Cul7 T A 17: 46,965,521 (GRCm39) H566Q probably benign Het
Cyp2b10 A G 7: 25,614,204 (GRCm39) Y226C probably damaging Het
Dennd2a A T 6: 39,499,743 (GRCm39) V274D probably benign Het
Dmbt1 G A 7: 130,663,093 (GRCm39) probably null Het
Drc7 T C 8: 95,794,684 (GRCm39) I363T probably benign Het
Drd3 G A 16: 43,643,047 (GRCm39) V396I probably benign Het
Dync2i1 A T 12: 116,218,130 (GRCm39) probably null Het
Eif2ak4 A G 2: 118,280,795 (GRCm39) N1054S probably benign Het
Epc1 A C 18: 6,450,084 (GRCm39) V458G probably damaging Het
Exoc1 T A 5: 76,685,562 (GRCm39) D91E probably damaging Het
Fat4 T A 3: 38,943,485 (GRCm39) F793I probably damaging Het
Fhod1 T C 8: 106,074,469 (GRCm39) E6G unknown Het
Galnt16 G A 12: 80,628,084 (GRCm39) probably null Het
Ganc A T 2: 120,286,582 (GRCm39) T804S probably benign Het
Gpam A T 19: 55,070,062 (GRCm39) V398E possibly damaging Het
Gpr68 A G 12: 100,844,623 (GRCm39) V307A probably benign Het
Grm7 C T 6: 111,335,722 (GRCm39) S711L probably damaging Het
Hemgn T A 4: 46,397,034 (GRCm39) R67S probably damaging Het
Hmg20b T C 10: 81,182,493 (GRCm39) D281G possibly damaging Het
Ifi211 A C 1: 173,729,401 (GRCm39) F277V probably damaging Het
Ighmbp2 T C 19: 3,322,981 (GRCm39) I322V probably benign Het
Iqce A T 5: 140,671,830 (GRCm39) L265H probably damaging Het
Itgal G T 7: 126,898,960 (GRCm39) A101S probably benign Het
Kif5a C T 10: 127,073,248 (GRCm39) M647I probably benign Het
Kirrel1 G T 3: 87,002,988 (GRCm39) T135K probably damaging Het
Klf16 T C 10: 80,412,622 (GRCm39) Y138C probably benign Het
Klhl7 A G 5: 24,331,844 (GRCm39) T49A probably benign Het
Mr1 T C 1: 155,022,474 (GRCm39) probably benign Het
Mrc1 A T 2: 14,330,104 (GRCm39) I1238F probably damaging Het
Ncoa5 C T 2: 164,846,171 (GRCm39) M225I possibly damaging Het
Nf1 A T 11: 79,438,052 (GRCm39) T121S probably damaging Het
Ngfr T C 11: 95,465,147 (GRCm39) T234A probably benign Het
Ninj1 T G 13: 49,347,356 (GRCm39) F74V probably damaging Het
Npffr1 T C 10: 61,462,088 (GRCm39) V408A probably benign Het
Nsd2 T C 5: 34,003,570 (GRCm39) V240A probably damaging Het
Obi1 T C 14: 104,716,814 (GRCm39) T520A probably damaging Het
Or12d13 T A 17: 37,648,062 (GRCm39) E20D probably benign Het
Or2z2 A G 11: 58,345,992 (GRCm39) M261T probably damaging Het
Or7a35 T A 10: 78,853,379 (GRCm39) F74L probably benign Het
Or8b44 G A 9: 38,410,369 (GRCm39) V135I probably benign Het
Or8g34 T C 9: 39,373,173 (GRCm39) S146P possibly damaging Het
Ovol1 T C 19: 5,601,614 (GRCm39) H136R probably damaging Het
Prag1 T A 8: 36,569,760 (GRCm39) D114E possibly damaging Het
Pramel17 T C 4: 101,694,331 (GRCm39) N184S probably benign Het
Prss3b C A 6: 41,010,127 (GRCm39) R69L probably benign Het
Prss57 T A 10: 79,623,234 (GRCm39) H71L probably benign Het
Ptgs2 T C 1: 149,978,448 (GRCm39) F187L probably damaging Het
Ptprz1 A T 6: 22,959,779 (GRCm39) N92I probably damaging Het
Rab23 A T 1: 33,773,812 (GRCm39) T91S possibly damaging Het
Rag1 A G 2: 101,474,006 (GRCm39) S379P probably damaging Het
Ribc2 G T 15: 85,027,448 (GRCm39) D310Y probably damaging Het
Rims1 A G 1: 22,507,291 (GRCm39) Y620H probably damaging Het
Rock1 A C 18: 10,090,820 (GRCm39) V938G probably benign Het
Rsph10b A G 5: 143,886,244 (GRCm39) N314S possibly damaging Het
Sertad1 A G 7: 27,189,327 (GRCm39) D216G possibly damaging Het
Shisal1 G A 15: 84,290,914 (GRCm39) T131M probably benign Het
Slco6d1 T A 1: 98,425,252 (GRCm39) V600D probably damaging Het
Snapc2 T C 8: 4,305,314 (GRCm39) I232T probably damaging Het
Snx13 A G 12: 35,136,913 (GRCm39) S125G probably damaging Het
Srcin1 C T 11: 97,425,551 (GRCm39) R502H probably damaging Het
Tesmin A G 19: 3,442,218 (GRCm39) E167G possibly damaging Het
Tex10 T C 4: 48,468,787 (GRCm39) I129M possibly damaging Het
Tmem235 A G 11: 117,754,967 (GRCm39) S140G probably benign Het
Trim60 T A 8: 65,454,177 (GRCm39) D24V probably damaging Het
Ttc39c A G 18: 12,822,936 (GRCm39) E148G probably benign Het
Vmn2r70 G T 7: 85,214,243 (GRCm39) T303K probably benign Het
Wdr48 A T 9: 119,745,894 (GRCm39) T426S possibly damaging Het
Xirp2 A T 2: 67,346,326 (GRCm39) T2856S probably benign Het
Zswim8 A G 14: 20,770,001 (GRCm39) N1356S probably damaging Het
Other mutations in Ces2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01933:Ces2a APN 8 105,468,047 (GRCm39) makesense probably null
IGL02135:Ces2a APN 8 105,466,813 (GRCm39) missense probably benign 0.00
IGL02529:Ces2a APN 8 105,463,851 (GRCm39) splice site probably benign
IGL02625:Ces2a APN 8 105,466,910 (GRCm39) critical splice donor site probably null
IGL02869:Ces2a APN 8 105,465,691 (GRCm39) missense probably damaging 1.00
IGL03265:Ces2a APN 8 105,464,075 (GRCm39) missense possibly damaging 0.55
IGL03349:Ces2a APN 8 105,460,712 (GRCm39) missense probably damaging 0.99
R0010:Ces2a UTSW 8 105,468,028 (GRCm39) missense probably benign 0.00
R0318:Ces2a UTSW 8 105,467,456 (GRCm39) missense probably damaging 1.00
R0477:Ces2a UTSW 8 105,464,169 (GRCm39) missense probably damaging 0.99
R0561:Ces2a UTSW 8 105,464,165 (GRCm39) missense probably benign 0.35
R0619:Ces2a UTSW 8 105,462,742 (GRCm39) missense probably benign 0.00
R1665:Ces2a UTSW 8 105,464,187 (GRCm39) splice site probably benign
R1737:Ces2a UTSW 8 105,467,456 (GRCm39) missense probably damaging 0.98
R2266:Ces2a UTSW 8 105,466,822 (GRCm39) missense probably benign 0.02
R2267:Ces2a UTSW 8 105,466,822 (GRCm39) missense probably benign 0.02
R2269:Ces2a UTSW 8 105,466,822 (GRCm39) missense probably benign 0.02
R2288:Ces2a UTSW 8 105,464,069 (GRCm39) missense probably damaging 1.00
R2656:Ces2a UTSW 8 105,462,766 (GRCm39) missense probably benign 0.00
R3176:Ces2a UTSW 8 105,466,010 (GRCm39) splice site probably benign
R3906:Ces2a UTSW 8 105,465,940 (GRCm39) missense probably benign 0.00
R4344:Ces2a UTSW 8 105,463,766 (GRCm39) missense probably damaging 1.00
R4708:Ces2a UTSW 8 105,463,938 (GRCm39) missense probably benign 0.14
R4780:Ces2a UTSW 8 105,463,840 (GRCm39) missense probably damaging 1.00
R5434:Ces2a UTSW 8 105,464,041 (GRCm39) missense probably damaging 0.98
R5763:Ces2a UTSW 8 105,462,756 (GRCm39) missense probably benign 0.00
R5828:Ces2a UTSW 8 105,465,956 (GRCm39) missense probably benign 0.00
R6359:Ces2a UTSW 8 105,462,710 (GRCm39) missense probably benign 0.00
R6440:Ces2a UTSW 8 105,467,954 (GRCm39) missense probably benign 0.12
R7066:Ces2a UTSW 8 105,466,880 (GRCm39) missense probably damaging 0.99
R7267:Ces2a UTSW 8 105,465,672 (GRCm39) missense probably benign 0.20
R7395:Ces2a UTSW 8 105,466,273 (GRCm39) missense probably benign 0.35
R7455:Ces2a UTSW 8 105,464,154 (GRCm39) missense probably damaging 1.00
R7457:Ces2a UTSW 8 105,464,021 (GRCm39) missense possibly damaging 0.87
R7683:Ces2a UTSW 8 105,463,744 (GRCm39) missense probably benign 0.00
R8328:Ces2a UTSW 8 105,463,998 (GRCm39) missense probably damaging 1.00
R8336:Ces2a UTSW 8 105,465,665 (GRCm39) missense probably damaging 0.97
R9183:Ces2a UTSW 8 105,460,774 (GRCm39) missense possibly damaging 0.95
R9794:Ces2a UTSW 8 105,467,896 (GRCm39) missense probably benign 0.16
X0022:Ces2a UTSW 8 105,462,774 (GRCm39) missense probably damaging 1.00
Z1176:Ces2a UTSW 8 105,461,482 (GRCm39) missense probably damaging 1.00
Z1176:Ces2a UTSW 8 105,460,638 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TTGCTTCACATGGTGGTGAC -3'
(R):5'- GTAACCTCAGAATTACACCATCTG -3'

Sequencing Primer
(F):5'- TTATATCAGTACACCAGGCCATCTG -3'
(R):5'- ACACCATCTGCTTTTAATCTCACAC -3'
Posted On 2019-10-17